Avatar of lfolv

lfolv's solution

to Nucleotide Count in the TypeScript Track

Published at Sep 25 2019 · 0 comments
Instructions
Test suite
Solution

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

  • twigs are to birds nests as
  • nucleotides are to DNA as
  • legos are to lego houses as
  • words are to sentences as...

Setup

Go through the setup instructions for TypeScript to install the necessary dependencies:

https://exercism.io/tracks/typescript/installation

Requirements

Install assignment dependencies:

$ yarn install

Making the test suite pass

Execute the tests with:

$ yarn test

In the test suites all tests but the first have been skipped.

Once you get a test passing, you can enable the next one by changing xit to it.

Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

nucleotide-count.test.ts

import NucleotideCount from './nucleotide-count'

describe('count all nucleotides in a strand', () => {
  it('empty strand', () => {
    const expected = {
      A: 0,
      C: 0,
      G: 0,
      T: 0
    }
    expect(NucleotideCount.nucleotideCounts('')).toEqual(expected)
  })

  xit('can count one nucleotide in single-character input', () => {
    const expected = {
      A: 0,
      C: 0,
      G: 1,
      T: 0
    }
    expect(NucleotideCount.nucleotideCounts('G')).toEqual(expected)
  })

  xit('strand with repeated nucleotide', () => {
    const expected = {
      A: 0,
      C: 0,
      G: 7,
      T: 0
    }
    expect(NucleotideCount.nucleotideCounts('GGGGGGG')).toEqual(expected)
  })

  xit('strand with multiple nucleotides', () => {
    const expected = {
      A: 20,
      C: 12,
      G: 17,
      T: 21
    }
    expect(NucleotideCount.nucleotideCounts('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')).toEqual(expected)
  })

  xit('strand with invalid nucleotides', () => {
    const expected = 'Invalid nucleotide in strand'
    expect(() => {NucleotideCount.nucleotideCounts('AGXXACT')}).toThrowError(expected)
  })
})
interface Counter {
  [key: string]: number
}

class NucleotideCount {
  static nucleotideCounts(strand: string): Counter {
    const counter: Counter = {
      A: 0,
      C: 0,
      G: 0,
      T: 0
    }

    for (const nucleotide of strand) {
      if (counter[nucleotide] === undefined) {
        throw new Error('Invalid nucleotide in strand')
      }

      counter[nucleotide] += 1
    }

    return counter
  }
}

export default NucleotideCount

What can you learn from this solution?

A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

  • What compromises have been made?
  • Are there new concepts here that you could read more about to improve your understanding?