🎉 Exercism Research is now launched. Help Exercism, help science and have some fun at research.exercism.io 🎉
Avatar of Eruhenon

Eruhenon's solution

to Nucleotide Count in the Objective-C Track

Published at Jul 13 2018 · 1 comment
Instructions
Test suite
Solution

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

  • twigs are to birds nests as
  • nucleotides are to DNA as
  • legos are to lego houses as
  • words are to sentences as...

Setup

There are two different methods of getting set up to run the tests with Objective-C:

  • Create an Xcode project with a test target which will run the tests.
  • Use the ruby gem objc as a test runner utility.

Both are described in more detail here: http://exercism.io/languages/objective-c

Submitting Exercises

When submitting an exercise, make sure your solution file is in the same directory as the test code.

The submit command will look something like:

exercism submit <path-to-exercism-workspace>/objective-c/nucleotide-count/NucleotideCount.m

You can find the Exercism workspace by running exercism debug and looking for the line beginning with Workspace.

Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

NucleotideCountTest.m

#import <XCTest/XCTest.h>

#if __has_include("NucleotideCountExample.h")
# import "NucleotideCountExample.h"
# else
# import "NucleotideCount.h"
#endif

NS_ASSUME_NONNULL_BEGIN

@interface NucleotideCountTest : XCTestCase

@end

@implementation NucleotideCountTest

- (void)testEmptyDNAStringHasNoAdenosine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@""];
  NSUInteger result = [dna count:@"A"];
  NSUInteger expected = 0;
  XCTAssertEqual(expected,result);
}

- (void)testEmptyNucleotideCountStringHasNoNucleotides {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@""];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @0, @"T" : @0, @"C" : @0, @"G" : @0 };
  XCTAssertEqualObjects(results, expected);
}

- (void)testRepetitiveCytidineGetsCounted {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"CCCCC"];
  NSUInteger result = [dna count:@"C"];
  NSUInteger expected = 5;
  XCTAssertEqual(expected,result);
}

- (void)testRepetitiveSequenceHasOnlyGuanosine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"GGGGGGGG"];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @0, @"T" : @0, @"C" : @0, @"G" : @8 };
  XCTAssertEqualObjects(results, expected);
}

- (void)testCountsByThymidine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"GGGGGTAACCCGG"];
  NSUInteger result = [dna count:@"T"];
  NSUInteger expected = 1;
  XCTAssertEqual(expected,result);
}

- (void)testCountsANucleotideOnlyOnce {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"CGATTGGG"];
  NSUInteger result = [dna count:@"T"];
  NSUInteger expected = 2;
  XCTAssertEqual(expected,result);
}

- (void)testValidatesNucleotideCount {
  XCTAssertThrows([[NucleotideCount alloc] initWithStrand:@"John"]);
}

- (void)testCountsAllNucleotides {
  NSString *longStrand = @"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:longStrand];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @20, @"T" : @21, @"C" : @12, @"G" : @17 };
  XCTAssertEqualObjects(results, expected);
}

@end
NS_ASSUME_NONNULL_END
#import "DNA.h"

@implementation NSString (DNA)

- (NSArray *)characters {
    NSMutableArray *characters = [NSMutableArray new];
    for (int i = 0; i < self.length; i++) {
        [characters addObject:[NSString stringWithFormat:@"%c", [self characterAtIndex:i]]];
    }
    
    return [characters copy];
}

@end

@interface DNA ()

@property (nonatomic, strong) NSString *strand;

@end

@implementation DNA

- (instancetype)initWithStrand:(NSString *)strand {
    self = [super init];
    
    if (self) {
        [self validateStrand:strand againstComponents:[self nucleotides]];
        self.strand = strand;
    }
    
    return self;
}

- (NSUInteger)count:(NSString *)nucleotide {
    [self validateStrand:nucleotide againstComponents:[[self nucleotides] stringByAppendingString:@"U"]];
    return [[self nucleotideBucket] countForObject:nucleotide];
}

- (NSDictionary *)nucleotideCounts {
    NSMutableDictionary *results = [NSMutableDictionary new];
    NSArray *nucleotideElements = [[self nucleotides] characters];
    NSCountedSet *bucket = [self nucleotideBucket];
    
    [nucleotideElements enumerateObjectsUsingBlock:^(NSString *nucleotide, NSUInteger idx, BOOL *stop) {
        NSUInteger count = [bucket countForObject:nucleotide];
        results[nucleotide] = @(count);
    }];
    
    return [results copy];
}

- (void)validateStrand:(NSString *)strand againstComponents:(NSString *)components {
    NSMutableCharacterSet *validateCharacterSet = [NSMutableCharacterSet characterSetWithCharactersInString:components];
    NSCharacterSet *strandCharacterSet = [NSCharacterSet characterSetWithCharactersInString:strand];
    
    if (! [validateCharacterSet isSupersetOfSet:strandCharacterSet]) {
        [NSException raise:@"Invalid DNA input" format:@"Strand %@ is not a valid nucleotide strand", strand];
    }
}

- (NSString *)nucleotides {
    return @"ATCG";
}

- (NSCountedSet *)nucleotideBucket {
    return [NSCountedSet setWithArray:[self.strand characters]];
}

@end

Community comments

Find this solution interesting? Ask the author a question to learn more.
Avatar of Eruhenon
Eruhenon
Solution Author
commented about 6 years ago

I'm always seeing solutions in which one iterates over the whole string and picks a single character. Since I'm using NSCountedSet, I'm wondering which is actually better.

What can you learn from this solution?

A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

  • What compromises have been made?
  • Are there new concepts here that you could read more about to improve your understanding?