Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
Here is an analogy:
Go through the setup instructions for TypeScript to install the necessary dependencies:
https://exercism.io/tracks/typescript/installation
Install assignment dependencies:
$ yarn install
Execute the tests with:
$ yarn test
In the test suites all tests but the first have been skipped.
Once you get a test passing, you can enable the next one by changing xit
to
it
.
The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
import NucleotideCount from './nucleotide-count'
describe('count all nucleotides in a strand', () => {
it('empty strand', () => {
const expected = {
A: 0,
C: 0,
G: 0,
T: 0
}
expect(NucleotideCount.nucleotideCounts('')).toEqual(expected)
})
xit('can count one nucleotide in single-character input', () => {
const expected = {
A: 0,
C: 0,
G: 1,
T: 0
}
expect(NucleotideCount.nucleotideCounts('G')).toEqual(expected)
})
xit('strand with repeated nucleotide', () => {
const expected = {
A: 0,
C: 0,
G: 7,
T: 0
}
expect(NucleotideCount.nucleotideCounts('GGGGGGG')).toEqual(expected)
})
xit('strand with multiple nucleotides', () => {
const expected = {
A: 20,
C: 12,
G: 17,
T: 21
}
expect(NucleotideCount.nucleotideCounts('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')).toEqual(expected)
})
xit('strand with invalid nucleotides', () => {
const expected = 'Invalid nucleotide in strand'
expect(() => {NucleotideCount.nucleotideCounts('AGXXACT')}).toThrowError(expected)
})
})
export default class NucleotideCount {
static nucleotideCounts(nucleotide: string): { [key: string]: number } {
const result: { [key: string]: number } = { A: 0, C: 0, G: 0, T: 0 }
nucleotide.split('').forEach((key) => {
if (result[key] === undefined) {
throw new Error("Invalid nucleotide in strand")
}
++result[key]
})
return result
}
}
A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.
Here are some questions to help you reflect on this solution and learn the most from it.
Level up your programming skills with 3,103 exercises across 52 languages, and insightful discussion with our volunteer team of welcoming mentors. Exercism is 100% free forever.
Sign up Learn More
Community comments