Calculate the Hamming difference between two DNA strands.
A mutation is simply a mistake that occurs during the creation or copying of a nucleic acid, in particular DNA. Because nucleic acids are vital to cellular functions, mutations tend to cause a ripple effect throughout the cell. Although mutations are technically mistakes, a very rare mutation may equip the cell with a beneficial attribute. In fact, the macro effects of evolution are attributable by the accumulated result of beneficial microscopic mutations over many generations.
The simplest and most common type of nucleic acid mutation is a point mutation, which replaces one base with another at a single nucleotide.
By counting the number of differences between two homologous DNA strands taken from different genomes with a common ancestor, we get a measure of the minimum number of point mutations that could have occurred on the evolutionary path between the two strands.
This is called the 'Hamming distance'.
It is found by comparing two DNA strands and counting how many of the nucleotides are different from their equivalent in the other string.
GAGCCTACTAACGGGAT
CATCGTAATGACGGCCT
^ ^ ^ ^ ^ ^^
The Hamming distance between these two DNA strands is 7.
The Hamming distance is only defined for sequences of equal length. This means that based on the definition, each language could deal with getting sequences of equal length differently.
The Calculating Point Mutations problem at Rosalind http://rosalind.info/problems/hamm/
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
;; Load SRFI-64 lightweight testing specification
(use-modules (srfi srfi-64))
;; Suppress log file output. To write logs, comment out the following line:
(module-define! (resolve-module '(srfi srfi-64)) 'test-log-to-file #f)
(add-to-load-path (dirname (current-filename)))
(use-modules (hamming))
(test-begin "hamming")
(test-eqv "no-difference-between-empty-strands"
0
(hamming-distance "" ""))
(test-eqv "no-difference-between-identical-strands"
0
(hamming-distance "GATTACA" "GATTACA"))
(test-eqv "complete-hamming-distance-in-small-strand"
3
(hamming-distance "ACT" "GGA"))
(test-eqv "small-hamming-distance-in-middle-somewhere"
1
(hamming-distance "GGACG" "GGTCG"))
(test-eqv "larger-difference"
2
(hamming-distance "ACCAGGG" "ACTATGG"))
(test-error "invalid-to-get-distance-for-different-length-strings"
#t
(hamming-distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA"))
(test-end "hamming")
(define-module (hamming)
#:export (hamming-distance))
(define (compare-list sq1-list sq2-list)
(if (not (null? sq1-list))
(if (not (eq? (car sq1-list) (car sq2-list)))
(+ 1 (compare-list (cdr sq1-list) (cdr sq2-list)))
(compare-list (cdr sq1-list) (cdr sq2-list))
)
0
)
)
(define (hamming-distance sq1 sq2)
(define sq1-list (string->list sq1))
(define sq2-list (string->list sq2))
(if (eq? (length sq1-list) (length sq2-list))
(compare-list sq1-list sq2-list)
(throw 'lists-inequal)
)
)
A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.
Here are some questions to help you reflect on this solution and learn the most from it.
Level up your programming skills with 3,450 exercises across 52 languages, and insightful discussion with our volunteer team of welcoming mentors. Exercism is 100% free forever.
Sign up Learn More
Community comments