🎉 Exercism Research is now launched. Help Exercism, help science and have some fun at research.exercism.io 🎉
Avatar of masters3d

masters3d's solution

to Nucleotide Count in the Objective-C Track

Published at Jul 13 2018 · 0 comments
Instructions
Test suite
Solution

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

  • twigs are to birds nests as
  • nucleotides are to DNA as
  • legos are to lego houses as
  • words are to sentences as...

Setup

There are two different methods of getting set up to run the tests with Objective-C:

  • Create an Xcode project with a test target which will run the tests.
  • Use the ruby gem objc as a test runner utility.

Both are described in more detail here: http://exercism.io/languages/objective-c

Submitting Exercises

When submitting an exercise, make sure your solution file is in the same directory as the test code.

The submit command will look something like:

exercism submit <path-to-exercism-workspace>/objective-c/nucleotide-count/NucleotideCount.m

You can find the Exercism workspace by running exercism debug and looking for the line beginning with Workspace.

Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

NucleotideCountTest.m

#import <XCTest/XCTest.h>

#if __has_include("NucleotideCountExample.h")
# import "NucleotideCountExample.h"
# else
# import "NucleotideCount.h"
#endif

NS_ASSUME_NONNULL_BEGIN

@interface NucleotideCountTest : XCTestCase

@end

@implementation NucleotideCountTest

- (void)testEmptyDNAStringHasNoAdenosine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@""];
  NSUInteger result = [dna count:@"A"];
  NSUInteger expected = 0;
  XCTAssertEqual(expected,result);
}

- (void)testEmptyNucleotideCountStringHasNoNucleotides {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@""];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @0, @"T" : @0, @"C" : @0, @"G" : @0 };
  XCTAssertEqualObjects(results, expected);
}

- (void)testRepetitiveCytidineGetsCounted {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"CCCCC"];
  NSUInteger result = [dna count:@"C"];
  NSUInteger expected = 5;
  XCTAssertEqual(expected,result);
}

- (void)testRepetitiveSequenceHasOnlyGuanosine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"GGGGGGGG"];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @0, @"T" : @0, @"C" : @0, @"G" : @8 };
  XCTAssertEqualObjects(results, expected);
}

- (void)testCountsByThymidine {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"GGGGGTAACCCGG"];
  NSUInteger result = [dna count:@"T"];
  NSUInteger expected = 1;
  XCTAssertEqual(expected,result);
}

- (void)testCountsANucleotideOnlyOnce {
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:@"CGATTGGG"];
  NSUInteger result = [dna count:@"T"];
  NSUInteger expected = 2;
  XCTAssertEqual(expected,result);
}

- (void)testValidatesNucleotideCount {
  XCTAssertThrows([[NucleotideCount alloc] initWithStrand:@"John"]);
}

- (void)testCountsAllNucleotides {
  NSString *longStrand = @"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
  NucleotideCount *dna = [[NucleotideCount alloc] initWithStrand:longStrand];
  NSDictionary<NSString *, NSNumber *> *results = [dna nucleotideCounts];
  NSDictionary<NSString *, NSNumber *> *expected = @{ @"A": @20, @"T" : @21, @"C" : @12, @"G" : @17 };
  XCTAssertEqualObjects(results, expected);
}

@end
NS_ASSUME_NONNULL_END
//
//  NucleotideCount.m
//  exercismObjc
//
//  Created by Cheyo Jimenez on 4/6/16.
//  Copyright © 2016 Cheyo Jimenez. All rights reserved.
//

#import "NucleotideCount.h"

@interface DNA ()

+ (BOOL) isValid:(NSString *)input;
+ (void) throwExeption;
@end


@implementation DNA

+ (NSArray<NSString *> *) arrayFromString:(NSString *) input{
    
    NSMutableArray<NSString *> *wordsArray = [NSMutableArray array];
    
    for (int i = 0; i < [input length]; i++) {
        [wordsArray addObject:  [[input uppercaseString ] substringWithRange:NSMakeRange(i, 1)]  ];
    }
    return wordsArray;
}

+ (BOOL) isValid:(NSString *)input{
    
    NSMutableSet<NSString *> *unique =  [NSMutableSet set];
    NSArray<NSString *> *inputArray = [DNA arrayFromString:input];
    
    for (NSString *each in inputArray) {
        [unique addObject:each];
    }
    
    for (NSString *each in unique){
        if (   [each isEqualToString:@"A"] |
            [each isEqualToString:@"T"] |
            [each isEqualToString:@"C"] |
            [each isEqualToString:@"G"] |
            [each isEqualToString:@"U"]
            )
        {}
        else {
            return false;
        }
    }
    return [unique count] <= 4;
}

+ (void) throwExeption{
    [NSException raise:@"Invalid value" format:@" input is invalid"];
}

NSString * value;

- (id) initWithStrand: (NSString *)input {
    
    if ([input containsString:@"U"]){
        [DNA throwExeption];
    }
    
    if (![DNA isValid:input]) {
        [DNA throwExeption];
    }
    value = [input uppercaseString];
    return self;
}

- (NSUInteger) count:(NSString *)input{
    
    if (![DNA isValid:input]){
        [DNA throwExeption];
    }
    
    NSInteger componentsCount = [[value componentsSeparatedByString:[input uppercaseString]] count];
    
    NSUInteger result = componentsCount - 1;
    
    if (result == -1) {
        [DNA throwExeption];
    }
    return result;
}

- (NSDictionary *) nucleotideCounts{
    
    NSMutableDictionary *didRetun = [NSMutableDictionary dictionary];
    
    for (NSString *each in @[@"A", @"T", @"C", @"G"]) {
        NSUInteger result = [[value componentsSeparatedByString:each] count]- 1;
        if ([value containsString:each]){
            [didRetun setValue:[NSNumber numberWithUnsignedInteger:result] forKey:each] ;
        } else {
            [didRetun setValue:[NSNumber numberWithInt:0] forKey:each];
        }
    }
    return didRetun;
}

@end

Community comments

Find this solution interesting? Ask the author a question to learn more.

What can you learn from this solution?

A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

  • What compromises have been made?
  • Are there new concepts here that you could read more about to improve your understanding?