PatrickMcSweeny's solution to Nucleotide Count on the JavaScript track

Instructions

Test suite

Solution

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

twigs are to birds nests as
nucleotides are to DNA as
legos are to lego houses as
words are to sentences as...

Setup

Go through the setup instructions for Javascript to install the necessary dependencies:

https://exercism.io/tracks/javascript/installation

Requirements

Install assignment dependencies:

$ npm install

Making the test suite pass

Execute the tests with:

$ npm test

In the test suites all tests but the first have been skipped.

Once you get a test passing, you can enable the next one by changing xtest to test.

Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

nucleotide-count.spec.js

import { NucleotideCounts } from './nucleotide-count';

describe('count all nucleotides in a strand', () => {
  test('empty strand', () => {
    expect(NucleotideCounts.parse('')).toEqual('0 0 0 0');
  });

  xtest('can count one nucleotide in single-character input', () => {
    expect(NucleotideCounts.parse('G')).toEqual('0 0 1 0');
  });

  xtest('strand with repeated nucleotide', () => {
    expect(NucleotideCounts.parse('GGGGGGG')).toEqual('0 0 7 0');
  });

  xtest('strand with multiple nucleotides', () => {
    expect(NucleotideCounts.parse('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')).toEqual('20 12 17 21');
  });

  xtest('strand with invalid nucleotides', () => {
    expect(() => NucleotideCounts.parse('AGXXACT')).toThrow(new Error('Invalid nucleotide in strand'));
  });
});

export class NucleotideCounts {
  static parse(strand) {
    let strandChars = strand.split("");
    let dnaTypes = ["A", "C", "G", "T"];

    if(strandChars.some(char => !dnaTypes.includes(char))){
      throw "Invalid nucleotide in strand";
    }

    return dnaTypes.map(type => {
      return strandChars.filter(char => char === type).length;
    })
    .map(num => num.toString())
    .join(" ");
  }
}

Community comments

Find this solution interesting? Ask the author a question to learn more.

What can you learn from this solution?

A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

What compromises have been made?
Are there new concepts here that you could read more about to improve your understanding?

PatrickMcSweeny's solution

to Nucleotide Count in the JavaScript Track