Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
Here is an analogy:
Since this exercise has difficulty 5 it doesn't come with any starter implementation. This is so that you get to practice creating classes and methods which is an important part of programming in Java. It does mean that when you first try to run the tests, they won't compile. They will give you an error similar to:
path-to-exercism-dir\exercism\java\name-of-exercise\src\test\java\ExerciseClassNameTest.java:14: error: cannot find symbol
ExerciseClassName exerciseClassName = new ExerciseClassName();
^
symbol: class ExerciseClassName
location: class ExerciseClassNameTest
This error occurs because the test refers to a class that hasn't been created yet (ExerciseClassName).
To resolve the error you need to add a file matching the class name in the error to the src/main/java directory.
For example, for the error above you would add a file called ExerciseClassName.java.
When you try to run the tests again you will get slightly different errors. You might get an error similar to:
constructor ExerciseClassName in class ExerciseClassName cannot be applied to given types;
ExerciseClassName exerciseClassName = new ExerciseClassName("some argument");
^
required: no arguments
found: String
reason: actual and formal argument lists differ in length
This error means that you need to add a constructor to your new class. If you don't add a constructor, Java will add a default one for you. This default constructor takes no arguments. So if the tests expect your class to have a constructor which takes arguments, then you need to create this constructor yourself. In the example above you could add:
ExerciseClassName(String input) {
}
That should make the error go away, though you might need to add some more code to your constructor to make the test pass!
You might also get an error similar to:
error: cannot find symbol
assertEquals(expectedOutput, exerciseClassName.someMethod());
^
symbol: method someMethod()
location: variable exerciseClassName of type ExerciseClassName
This error means that you need to add a method called someMethod to your new class.
In the example above you would add:
String someMethod() {
return "";
}
Make sure the return type matches what the test is expecting.
You can find out which return type it should have by looking at the type of object it's being compared to in the tests.
Or you could set your method to return some random type (e.g. void), and run the tests again.
The new error should tell you which type it's expecting.
After having resolved these errors you should be ready to start making the tests pass!
You can run all the tests for an exercise by entering
$ gradle test
in your terminal.
The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
import org.junit.Ignore;
import org.junit.Test;
import org.junit.Rule;
import org.junit.rules.ExpectedException;
import java.util.Map;
import static org.hamcrest.Matchers.*;
import static org.junit.Assert.*;
public class NucleotideCounterTest {
@Rule
public ExpectedException expectedException = ExpectedException.none();
@Test
public void testEmptyDnaStringHasNoNucleotides() {
NucleotideCounter nucleotideCounter = new NucleotideCounter("");
Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
assertThat(counts, allOf(
hasEntry('A', 0),
hasEntry('C', 0),
hasEntry('G', 0),
hasEntry('T', 0)
));
}
@Ignore("Remove to run test")
@Test
public void testDnaStringHasOneNucleotide() {
NucleotideCounter nucleotideCounter = new NucleotideCounter("G");
Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
assertThat(counts, allOf(
hasEntry('A', 0),
hasEntry('C', 0),
hasEntry('G', 1),
hasEntry('T', 0)
));
}
@Ignore("Remove to run test")
@Test
public void testRepetitiveSequenceWithOnlyGuanine() {
NucleotideCounter nucleotideCounter = new NucleotideCounter("GGGGGGG");
Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
assertThat(counts, allOf(
hasEntry('A', 0),
hasEntry('C', 0),
hasEntry('G', 7),
hasEntry('T', 0)
));
}
@Ignore("Remove to run test")
@Test
public void testDnaStringHasMultipleNucleotide() {
NucleotideCounter nucleotideCounter
= new NucleotideCounter("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC");
Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
assertThat(counts, allOf(
hasEntry('A', 20),
hasEntry('C', 12),
hasEntry('G', 17),
hasEntry('T', 21)
));
}
@Ignore("Remove to run test")
@Test
public void testDnaStringHasInvalidNucleotides() {
expectedException.expect(IllegalArgumentException.class);
NucleotideCounter nucleotideCounter = new NucleotideCounter("AGXXACT");
}
}import java.util.HashMap;
import java.util.Map;
public class DNA {
private Map<Character, Integer> nucleoTide = new HashMap<Character, Integer>();
public DNA(String dnaString) {
nucleoTide.put('A', 0);
nucleoTide.put('C', 0);
nucleoTide.put('G', 0);
nucleoTide.put('T', 0);
for (int i = 0; i < dnaString.length(); i++) {
char charAt = dnaString.charAt(i);
if (nucleoTide.containsKey(charAt)) {
nucleoTide.put(charAt, nucleoTide.get(charAt) + 1);
}
}
}
public Map<Character, Integer> nucleotideCounts() {
return nucleoTide;
}
public int count(char key) {
if (nucleoTide.containsKey(key)) {
return nucleoTide.get(key);
} else {
throw new IllegalArgumentException();
}
}
}A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.
Here are some questions to help you reflect on this solution and learn the most from it.
Level up your programming skills with 3,449 exercises across 52 languages, and insightful discussion with our volunteer team of welcoming mentors. Exercism is 100% free forever.
Sign up Learn More
Community comments
it is usually not a good idea to do much work (other than simple assignments) in constructors. and you could have a private helper method for the for-loop.
@abo64 Why is that? I would have thought it'd be better to do as much work as possible in the constructor so that if the count is requested multiple times the actual counting is only done once.
among other things it is problematic for dependency injection and testing. here is a good article: http://misko.hevery.com/code-reviewers-guide/flaw-constructor-does-real-work/ but I agree that you should not do the same work more than once. in other languages you have special constructs (like the lazy keyword in Scala). in Java you can imitate this by having a private instance variable initialized to null, then do the computation for the first call and set it to the computation value.
@wlspaldi I think the constructor always get called no matter what the method is called. so it is like the minimize the expense of the calculation to the method itself. and having private instance and store the value to that once it has calculated is good idea I think