Exercism v3 launches on Sept 1st 2021. Learn more! ๐Ÿš€๐Ÿš€๐Ÿš€
Avatar of rootulp

rootulp's solution

to Nucleotide Count in the Elm Track

Published at Jul 13 2018 · 0 comments
Instructions
Test suite
Solution

Note:

This solution was written on an old version of Exercism. The tests below might not correspond to the solution code, and the exercise may have changed since this code was written.

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

  • twigs are to birds nests as
  • nucleotides are to DNA as
  • legos are to lego houses as
  • words are to sentences as...

Elm Installation

Refer to the Exercism help page for Elm installation and learning resources.

Writing the Code

The first time you start an exercise, you'll need to ensure you have the appropriate dependencies installed.

$ elm-package install --yes

Execute the tests with:

$ elm-test

Automatically run tests again when you save changes:

$ elm-test --watch

As you work your way through the test suite, be sure to remove the skip <| calls from each test until you get them all passing!

Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

Tests.elm

module Tests exposing (..)

import Expect
import NucleotideCount exposing (nucleotideCounts, version)
import Test exposing (..)


tests : Test
tests =
    describe "NucleotideCount"
        [ test "the solution is for the correct version of the test" <|
            \() -> Expect.equal 2 version
        , test "empty dna strand has no nucleotides" <|
            \() ->
                Expect.equal { a = 0, t = 0, c = 0, g = 0 }
                    (nucleotideCounts "")
        , skip <|
            test "repetitive sequence has only guanine" <|
                \() ->
                    Expect.equal { a = 0, t = 0, c = 0, g = 8 }
                        (nucleotideCounts "GGGGGGGG")
        , skip <|
            test "counts all nucleotides" <|
                \() ->
                    Expect.equal { a = 20, t = 21, c = 12, g = 17 }
                        (nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
        ]

elm-package.json

{
    "version": "3.0.0",
    "summary": "Exercism problems in Elm.",
    "repository": "https://github.com/exercism/elm.git",
    "license": "BSD3",
    "source-directories": [
        ".",
        ".."
    ],
    "exposed-modules": [],
    "dependencies": {
        "elm-lang/core": "5.0.0 <= v < 6.0.0",
        "elm-community/elm-test": "4.0.0 <= v < 5.0.0"
    },
    "elm-version": "0.18.0 <= v < 0.19.0"
}
module NucleotideCount exposing (..)

import Dict exposing (Dict)


type alias NucleotideCounts = {
  a : Int,
  t : Int,
  c : Int,
  g : Int
}

nucleotideCounts: String -> NucleotideCounts
nucleotideCounts strand =
  let occurencesInStrand = occurencesIn strand in
  { a = occurencesInStrand 'A'
  , t = occurencesInStrand 'T'
  , c = occurencesInStrand 'C'
  , g = occurencesInStrand 'G'
  }


occurencesIn: String -> Char -> Int
occurencesIn strand nucleotide =
  let nucleotideOccurences = occurences strand in
  nucleotideOccurences
    |> Dict.get nucleotide
    |> Maybe.withDefault 0


occurences: String -> Dict Char Int
occurences strand =
  strand
    |> String.toList
    |> List.foldl populateDict Dict.empty


populateDict : Char -> Dict Char Int -> Dict Char Int
populateDict nucleotide dict =
    Dict.update nucleotide incrementValue dict


incrementValue : Maybe Int -> Maybe Int
incrementValue maybe =
    Maybe.withDefault 0 maybe
        + 1
        |> Just


version : Int
version =
  2

Community comments

Find this solution interesting? Ask the author a question to learn more.

What can you learn from this solution?

A huge amount can be learned from reading other peopleโ€™s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

  • What compromises have been made?
  • Are there new concepts here that you could read more about to improve your understanding?