Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
Here is an analogy:
This exercise requires the use of a Dictionary. For more information see this page.
To run the tests, run the command dotnet test
from within the exercise directory.
Initially, only the first test will be enabled. This is to encourage you to solve the exercise one step at a time.
Once you get the first test passing, remove the Skip
property from the next test and work on getting that test passing.
Once none of the tests are skipped and they are all passing, you can submit your solution
using exercism submit NucleotideCount.cs
For more detailed information about the C# track, including how to get help if you're having trouble, please visit the exercism.io C# language page.
The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/
// This file was auto-generated based on version 1.3.0 of the canonical data.
using System;
using System.Collections.Generic;
using Xunit;
public class NucleotideCountTest
{
[Fact]
public void Empty_strand()
{
var expected = new Dictionary<char, int>
{
['A'] = 0,
['C'] = 0,
['G'] = 0,
['T'] = 0
};
Assert.Equal(expected, NucleotideCount.Count(""));
}
[Fact(Skip = "Remove to run test")]
public void Can_count_one_nucleotide_in_single_character_input()
{
var expected = new Dictionary<char, int>
{
['A'] = 0,
['C'] = 0,
['G'] = 1,
['T'] = 0
};
Assert.Equal(expected, NucleotideCount.Count("G"));
}
[Fact(Skip = "Remove to run test")]
public void Strand_with_repeated_nucleotide()
{
var expected = new Dictionary<char, int>
{
['A'] = 0,
['C'] = 0,
['G'] = 7,
['T'] = 0
};
Assert.Equal(expected, NucleotideCount.Count("GGGGGGG"));
}
[Fact(Skip = "Remove to run test")]
public void Strand_with_multiple_nucleotides()
{
var expected = new Dictionary<char, int>
{
['A'] = 20,
['C'] = 12,
['G'] = 17,
['T'] = 21
};
Assert.Equal(expected, NucleotideCount.Count("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"));
}
[Fact(Skip = "Remove to run test")]
public void Strand_with_invalid_nucleotides()
{
Assert.Throws<ArgumentException>(() => NucleotideCount.Count("AGXXACT"));
}
}
using System;
using System.Collections.Generic;
public static class NucleotideCount {
public static IDictionary<char, int> Count (string sequence) {
var dnaFrequency = new Dictionary<char, int> {
['A'] = 0,
['C'] = 0,
['G'] = 0,
['T'] = 0
};
foreach (var dna in sequence) {
if (dnaFrequency.ContainsKey(dna))
{
dnaFrequency[dna]++;
}
else
{
throw new ArgumentException("The DNA not found!");
}
}
return dnaFrequency;
}
}
A huge amount can be learned from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.
Here are some questions to help you reflect on this solution and learn the most from it.
Level up your programming skills with 3,450 exercises across 52 languages, and insightful discussion with our volunteer team of welcoming mentors. Exercism is 100% free forever.
Sign up Learn More
Community comments