Avatar of 4d47
0
0
Genius
0
1

4d47's solution

to Hamming in the Clojure Track

Instructions
Test suite
Solution

Calculate the Hamming difference between two DNA strands.

A mutation is simply a mistake that occurs during the creation or copying of a nucleic acid, in particular DNA. Because nucleic acids are vital to cellular functions, mutations tend to cause a ripple effect throughout the cell. Although mutations are technically mistakes, a very rare mutation may equip the cell with a beneficial attribute. In fact, the macro effects of evolution are attributable by the accumulated result of beneficial microscopic mutations over many generations.

The simplest and most common type of nucleic acid mutation is a point mutation, which replaces one base with another at a single nucleotide.

By counting the number of differences between two homologous DNA strands taken from different genomes with a common ancestor, we get a measure of the minimum number of point mutations that could have occurred on the evolutionary path between the two strands.

This is called the 'Hamming distance'.

It is found by comparing two DNA strands and counting how many of the nucleotides are different from their equivalent in the other string.

GAGCCTACTAACGGGAT
CATCGTAATGACGGCCT
^ ^ ^  ^ ^    ^^

The Hamming distance between these two DNA strands is 7.

Implementation notes

The Hamming distance is only defined for sequences of equal length, so an attempt to calculate it between sequences of different lengths should not work. The general handling of this situation (e.g., raising an exception vs returning a special value) may differ between languages.

Source

The Calculating Point Mutations problem at Rosalind http://rosalind.info/problems/hamm/

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

hamming_test.clj

(ns hamming-test
  (:require [clojure.test :refer [deftest is]]
            hamming))

(deftest no-difference-between-empty-strands
  (is (= 0 (hamming/distance "" ""))))

(deftest no-difference-between-identical-strands
  (is (= 0 (hamming/distance "GGACTGA" "GGACTGA"))))

(deftest complete-distance-in-small-strand
  (is (= 3 (hamming/distance "ACT" "GGA"))))

(deftest small-distance-in-middle-somewhere
  (is (= 1 (hamming/distance "GGACG" "GGTCG"))))

(deftest larger-distance
  (is (= 2 (hamming/distance "ACCAGGG" "ACTATGG"))))

(deftest undefined-when-lengths-are-different
  (is (= nil (hamming/distance "AAAC" "TAGGGGAGGCTAGCGGTAGGAC")))
  (is (= nil (hamming/distance "GACTACGGACAGGGTAACATAG" "GACA"))))
(ns hamming)

(defn distance [a b]
  (if (= (count a) (count b))
    (apply + (map #(if (= %1 %2) 0 1) a b))))

What can you learn from this solution?

A huge amount can be learnt from reading other people’s code. This is why we wanted to give exercism users the option of making their solutions public.

Here are some questions to help you reflect on this solution and learn the most from it.

  • What compromises have been made?
  • Are there new concepts here that I could read more about to develop my understanding?

Community comments

See what others have said about this solution
10 months ago
4d47 says

map can take multiple args, duh