1
exercism fetch kotlin nucleotide-count

src/test/kotlin/DnaTest.kt

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
import org.junit.Test
import org.junit.Ignore
import kotlin.test.assertEquals

class DnaTest {

    @Test
    fun emptyDnaStringHasNoNucleotides() {
        val dna = Dna("")
        val expected = mapOf('A' to 0, 'C' to 0, 'G' to 0, 'T' to 0)

        assertEquals(expected, dna.nucleotideCounts)
    }

    @Ignore
    @Test
    fun canCountOneNucleotideInSingleCharacterInput() {
        val dna = Dna("G")
        val expected = mapOf('A' to 0, 'C' to 0, 'G' to 1, 'T' to 0)

        assertEquals(expected, dna.nucleotideCounts)
    }

    @Ignore
    @Test
    fun canCountRepeatedNucleotide() {
        val dna = Dna("GGGGGGG")
        val expected = mapOf('A' to 0, 'C' to 0, 'G' to 7, 'T' to 0)

        assertEquals(expected, dna.nucleotideCounts)
    }

    @Ignore
    @Test
    fun canCountMultipleNucleotides() {
        val dna = Dna("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
        val expected = mapOf('A' to 20, 'C' to 12, 'G' to 17, 'T' to 21)

        assertEquals(expected, dna.nucleotideCounts)
    }

    @Ignore
    @Test(expected = IllegalArgumentException::class)
    fun validatesNucleotides() {
        Dna("AGXXACT")
    }

}