1
exercism fetch elm nucleotide-count

tests/Tests.elm

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
module Tests exposing (..)

import Test exposing (..)
import Expect
import NucleotideCount exposing (nucleotideCounts, version)


tests : Test
tests =
    describe "NucleotideCount"
        [ test "the solution is for the correct version of the test" <|
            \() -> Expect.equal 2 version
        , test "empty dna strand has no nucleotides" <|
            \() ->
                Expect.equal { a = 0, t = 0, c = 0, g = 0 }
                    (nucleotideCounts "")
        , skip <|
            test "repetitive sequence has only guanine" <|
                \() ->
                    Expect.equal { a = 0, t = 0, c = 0, g = 8 }
                        (nucleotideCounts "GGGGGGGG")
        , skip <|
            test "counts all nucleotides" <|
                \() ->
                    Expect.equal { a = 20, t = 21, c = 12, g = 17 }
                        (nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
        ]

tests/elm-package.json

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
{
    "version": "3.0.0",
    "summary": "Exercism problems in Elm.",
    "repository": "https://github.com/exercism/elm.git",
    "license": "BSD3",
    "source-directories": [
        ".",
        ".."
    ],
    "exposed-modules": [],
    "dependencies": {
        "elm-lang/core": "5.0.0 <= v < 6.0.0",
        "elm-community/elm-test": "4.0.0 <= v < 5.0.0"
    },
    "elm-version": "0.18.0 <= v < 0.19.0"
}