1
exercism fetch elixir nucleotide-count

nucleotide_count_test.exs

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
if !System.get_env("EXERCISM_TEST_EXAMPLES") do
  Code.load_file("nucleotide_count.exs", __DIR__)
end

ExUnit.start
ExUnit.configure exclude: :pending, trace: true

defmodule NucleotideCountTest do
  use ExUnit.Case

  # @tag :pending
  test "empty dna string has no adenine" do
    assert NucleotideCount.count('', ?A) == 0
  end

  @tag :pending
  test "repetitive cytosine gets counted" do
    assert NucleotideCount.count('CCCCC', ?C) == 5
  end

  @tag :pending
  test "counts only thymine" do
    assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
  end

  @tag :pending
  test "empty dna string has no nucleotides" do
    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
    assert NucleotideCount.histogram('') == expected
  end

  @tag :pending
  test "repetitive sequence has only guanine" do
    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
    assert NucleotideCount.histogram('GGGGGGGG') == expected
  end

  @tag :pending
  test "counts all nucleotides" do
    s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
    expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
    assert NucleotideCount.histogram(s) == expected
  end
end