1
exercism fetch c nucleotide-count

test/test_nucleotide_count.c

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
#include "vendor/unity.h"
#include "../src/nucleotide_count.h"
#include <stdlib.h>
#include <string.h>

void setUp(void)
{
}

void tearDown(void)
{
}

void test_strand_count(const char *dna_strand, const char *expected)
{
   char *actual_count = count(dna_strand);

   TEST_ASSERT_TRUE(strcmp(actual_count, expected) == 0);
   free(actual_count);
}

void test_empty_strand(void)
{
   TEST_IGNORE();               // delete this line to run test
   const char *dna_strand = "";
   const char *expected = "A:0 C:0 G:0 T:0";

   test_strand_count(dna_strand, expected);
}

void test_repeated_nucleotide(void)
{
   TEST_IGNORE();
   const char *dna_strand = "GGGGGGG";
   const char *expected = "A:0 C:0 G:7 T:0";

   test_strand_count(dna_strand, expected);
}

void test_multiple_nucleotides(void)
{
   TEST_IGNORE();
   const char *dna_strand =
       "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
   const char *expected = "A:20 C:12 G:17 T:21";

   test_strand_count(dna_strand, expected);
}

void test_invalid_nucleotide(void)
{
   TEST_IGNORE();
   const char *dna_strand = "AGXXACT";
   const char *expected = "";

   test_strand_count(dna_strand, expected);
}

int main(void)
{
   UnityBegin("test/test_rna_transcription.c");

   RUN_TEST(test_empty_strand);
   RUN_TEST(test_repeated_nucleotide);
   RUN_TEST(test_multiple_nucleotides);
   RUN_TEST(test_invalid_nucleotide);

   UnityEnd();
   return 0;
}

test/vendor/unity.c

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
/* =========================================================================
    Unity Project - A Test Framework for C
    Copyright (c) 2007-14 Mike Karlesky, Mark VanderVoord, Greg Williams
    [Released under MIT License. Please refer to license.txt for details]
============================================================================ */

#include "unity.h"
#include <stddef.h>

#define UNITY_FAIL_AND_BAIL   { Unity.CurrentTestFailed  = 1; longjmp(Unity.AbortFrame, 1); }
#define UNITY_IGNORE_AND_BAIL { Unity.CurrentTestIgnored = 1; longjmp(Unity.AbortFrame, 1); }
/// return prematurely if we are already in failure or ignore state
#define UNITY_SKIP_EXECUTION  { if ((Unity.CurrentTestFailed != 0) || (Unity.CurrentTestIgnored != 0)) {return;} }
#define UNITY_PRINT_EOL       { UNITY_OUTPUT_CHAR('\n'); }

struct _Unity Unity;

const char UnityStrOk[]                     = "OK";
const char UnityStrPass[]                   = "PASS";
const char UnityStrFail[]                   = "FAIL";
const char UnityStrIgnore[]                 = "IGNORE";
const char UnityStrNull[]                   = "NULL";
const char UnityStrSpacer[]                 = ". ";
const char UnityStrExpected[]               = " Expected ";
const char UnityStrWas[]                    = " Was ";
const char UnityStrTo[]                     = " To ";
const char UnityStrElement[]                = " Element ";
const char UnityStrByte[]                   = " Byte ";
const char UnityStrMemory[]                 = " Memory Mismatch.";
const char UnityStrDelta[]                  = " Values Not Within Delta ";
const char UnityStrPointless[]              = " You Asked Me To Compare Nothing, Which Was Pointless.";
const char UnityStrNullPointerForExpected[] = " Expected pointer to be NULL";
const char UnityStrNullPointerForActual[]   = " Actual pointer was NULL";
const char UnityStrNot[]                    = "Not ";
const char UnityStrInf[]                    = "Infinity";
const char UnityStrNegInf[]                 = "Negative Infinity";
const char UnityStrNaN[]                    = "NaN";
const char UnityStrDet[]                    = "Determinate";
const char UnityStrErrFloat[]               = "Unity Floating Point Disabled";
const char UnityStrErrDouble[]              = "Unity Double Precision Disabled";
const char UnityStrErr64[]                  = "Unity 64-bit Support Disabled";
const char UnityStrBreaker[]                = "-----------------------";
const char UnityStrResultsTests[]           = " Tests ";
const char UnityStrResultsFailures[]        = " Failures ";
const char UnityStrResultsIgnored[]         = " Ignored ";

#ifndef UNITY_EXCLUDE_FLOAT
// Dividing by these constants produces +/- infinity.
// The rationale is given in UnityAssertFloatIsInf's body.
static const _UF f_zero = 0.0f;
#ifndef UNITY_EXCLUDE_DOUBLE
static const _UD d_zero = 0.0;
#endif
#endif

// compiler-generic print formatting masks
const _U_UINT UnitySizeMask[] =
{
    255u,         // 0xFF
    65535u,       // 0xFFFF
    65535u,
    4294967295u,  // 0xFFFFFFFF
    4294967295u,
    4294967295u,
    4294967295u
#ifdef UNITY_SUPPORT_64
    ,0xFFFFFFFFFFFFFFFF
#endif
};

void UnityPrintFail(void);
void UnityPrintOk(void);

//-----------------------------------------------
// Pretty Printers & Test Result Output Handlers
//-----------------------------------------------

void UnityPrint(const char* string)
{
    const char* pch = string;

    if (pch != NULL)
    {
        while (*pch)
        {
            // printable characters plus CR & LF are printed
            if ((*pch <= 126) && (*pch >= 32))
            {
                UNITY_OUTPUT_CHAR(*pch);
            }
            //write escaped carriage returns
            else if (*pch == 13)
            {
                UNITY_OUTPUT_CHAR('\\');
                UNITY_OUTPUT_CHAR('r');
            }
            //write escaped line feeds
            else if (*pch == 10)
            {
                UNITY_OUTPUT_CHAR('\\');
                UNITY_OUTPUT_CHAR('n');
            }
            // unprintable characters are shown as codes
            else
            {
                UNITY_OUTPUT_CHAR('\\');
                UnityPrintNumberHex((_U_UINT)*pch, 2);
            }
            pch++;
        }
    }
}

void UnityPrintLen(const char* string, const _UU32 length);
void UnityPrintLen(const char* string, const _UU32 length)
{
    const char* pch = string;

    if (pch != NULL)
    {
        while (*pch && (_UU32)(pch - string) < length)
        {
            // printable characters plus CR & LF are printed
            if ((*pch <= 126) && (*pch >= 32))
            {
                UNITY_OUTPUT_CHAR(*pch);
            }
            //write escaped carriage returns
            else if (*pch == 13)
            {
                UNITY_OUTPUT_CHAR('\\');
                UNITY_OUTPUT_CHAR('r');
            }
            //write escaped line feeds
            else if (*pch == 10)
            {
                UNITY_OUTPUT_CHAR('\\');
                UNITY_OUTPUT_CHAR('n');
            }
            // unprintable characters are shown as codes
            else
            {
                UNITY_OUTPUT_CHAR('\\');
                UnityPrintNumberHex((_U_UINT)*pch, 2);
            }
            pch++;
        }
    }
}

//-----------------------------------------------
void UnityPrintNumberByStyle(const _U_SINT number, const UNITY_DISPLAY_STYLE_T style)
{
    if ((style & UNITY_DISPLAY_RANGE_INT) == UNITY_DISPLAY_RANGE_INT)
    {
        UnityPrintNumber(number);
    }
    else if ((style & UNITY_DISPLAY_RANGE_UINT) == UNITY_DISPLAY_RANGE_UINT)
    {
        UnityPrintNumberUnsigned(  (_U_UINT)number  &  UnitySizeMask[((_U_UINT)style & (_U_UINT)0x0F) - 1]  );
    }
    else
    {
        UnityPrintNumberHex((_U_UINT)number, (char)((style & 0x000F) << 1));
    }
}

//-----------------------------------------------
/// basically do an itoa using as little ram as possible
void UnityPrintNumber(const _U_SINT number_to_print)
{
    _U_SINT divisor = 1;
    _U_SINT next_divisor;
    _U_UINT number;

    if (number_to_print == (1l << (UNITY_LONG_WIDTH-1)))
    {
        //The largest representable negative number
        UNITY_OUTPUT_CHAR('-');
        number = (1ul << (UNITY_LONG_WIDTH-1));
    }
    else if (number_to_print < 0)
    {
        //Some other negative number
        UNITY_OUTPUT_CHAR('-');
        number = (_U_UINT)(-number_to_print);
    }
    else
    {
        //Positive number
        number = (_U_UINT)number_to_print;
    }

    // figure out initial divisor
    while (number / divisor > 9)
    {
        next_divisor = divisor * 10;
        if (next_divisor > divisor)
            divisor = next_divisor;
        else
            break;
    }

    // now mod and print, then divide divisor
    do
    {
        UNITY_OUTPUT_CHAR((char)('0' + (number / divisor % 10)));
        divisor /= 10;
    }
    while (divisor > 0);
}

//-----------------------------------------------
/// basically do an itoa using as little ram as possible
void UnityPrintNumberUnsigned(const _U_UINT number)
{
    _U_UINT divisor = 1;
    _U_UINT next_divisor;

    // figure out initial divisor
    while (number / divisor > 9)
    {
        next_divisor = divisor * 10;
        if (next_divisor > divisor)
            divisor = next_divisor;
        else
            break;
    }

    // now mod and print, then divide divisor
    do
    {
        UNITY_OUTPUT_CHAR((char)('0' + (number / divisor % 10)));
        divisor /= 10;
    }
    while (divisor > 0);
}

//-----------------------------------------------
void UnityPrintNumberHex(const _U_UINT number, const char nibbles_to_print)
{
    _U_UINT nibble;
    char nibbles = nibbles_to_print;
    UNITY_OUTPUT_CHAR('0');
    UNITY_OUTPUT_CHAR('x');

    while (nibbles > 0)
    {
        nibble = (number >> (--nibbles << 2)) & 0x0000000F;
        if (nibble <= 9)
        {
            UNITY_OUTPUT_CHAR((char)('0' + nibble));
        }
        else
        {
            UNITY_OUTPUT_CHAR((char)('A' - 10 + nibble));
        }
    }
}

//-----------------------------------------------
void UnityPrintMask(const _U_UINT mask, const _U_UINT number)
{
    _U_UINT current_bit = (_U_UINT)1 << (UNITY_INT_WIDTH - 1);
    _US32 i;

    for (i = 0; i < UNITY_INT_WIDTH; i++)
    {
        if (current_bit & mask)
        {
            if (current_bit & number)
            {
                UNITY_OUTPUT_CHAR('1');
            }
            else
            {
                UNITY_OUTPUT_CHAR('0');
            }
        }
        else
        {
            UNITY_OUTPUT_CHAR('X');
        }
        current_bit = current_bit >> 1;
    }
}

//-----------------------------------------------
#ifdef UNITY_FLOAT_VERBOSE
#include <string.h>
void UnityPrintFloat(_UF number)
{
    char TempBuffer[32];
    sprintf(TempBuffer, "%.6f", number);
    UnityPrint(TempBuffer);
}
#endif

//-----------------------------------------------

void UnityPrintFail(void);
void UnityPrintFail(void)
{
    UnityPrint(UnityStrFail);
}

void UnityPrintOk(void);
void UnityPrintOk(void)
{
    UnityPrint(UnityStrOk);
}

//-----------------------------------------------
static void UnityTestResultsBegin(const char* file, const UNITY_LINE_TYPE line);
static void UnityTestResultsBegin(const char* file, const UNITY_LINE_TYPE line)
{
#ifndef UNITY_FIXTURES
    UnityPrint(file);
    UNITY_OUTPUT_CHAR(':');
    UnityPrintNumber((_U_SINT)line);
    UNITY_OUTPUT_CHAR(':');
    UnityPrint(Unity.CurrentTestName);
    UNITY_OUTPUT_CHAR(':');
#else
    UNITY_UNUSED(file);
    UNITY_UNUSED(line);
#endif
}

//-----------------------------------------------
static void UnityTestResultsFailBegin(const UNITY_LINE_TYPE line);
static void UnityTestResultsFailBegin(const UNITY_LINE_TYPE line)
{
#ifndef UNITY_FIXTURES
    UnityTestResultsBegin(Unity.TestFile, line);
#else
    UNITY_UNUSED(line);
#endif
    UnityPrint(UnityStrFail);
    UNITY_OUTPUT_CHAR(':');
}

//-----------------------------------------------
void UnityConcludeTest(void)
{
    if (Unity.CurrentTestIgnored)
    {
        Unity.TestIgnores++;
    }
    else if (!Unity.CurrentTestFailed)
    {
        UnityTestResultsBegin(Unity.TestFile, Unity.CurrentTestLineNumber);
        UnityPrint(UnityStrPass);
    }
    else
    {
        Unity.TestFailures++;
    }

    Unity.CurrentTestFailed = 0;
    Unity.CurrentTestIgnored = 0;
    UNITY_PRINT_EOL;
}

//-----------------------------------------------
static void UnityAddMsgIfSpecified(const char* msg);
static void UnityAddMsgIfSpecified(const char* msg)
{
    if (msg)
    {
        UnityPrint(UnityStrSpacer);
        UnityPrint(msg);
    }
}

//-----------------------------------------------
static void UnityPrintExpectedAndActualStrings(const char* expected, const char* actual);
static void UnityPrintExpectedAndActualStrings(const char* expected, const char* actual)
{
    UnityPrint(UnityStrExpected);
    if (expected != NULL)
    {
        UNITY_OUTPUT_CHAR('\'');
        UnityPrint(expected);
        UNITY_OUTPUT_CHAR('\'');
    }
    else
    {
      UnityPrint(UnityStrNull);
    }
    UnityPrint(UnityStrWas);
    if (actual != NULL)
    {
        UNITY_OUTPUT_CHAR('\'');
        UnityPrint(actual);
        UNITY_OUTPUT_CHAR('\'');
    }
    else
    {
      UnityPrint(UnityStrNull);
    }
}

//-----------------------------------------------
static void UnityPrintExpectedAndActualStringsLen(const char* expected, const char* actual, const _UU32 length)
{
    UnityPrint(UnityStrExpected);
    if (expected != NULL)
    {
        UNITY_OUTPUT_CHAR('\'');
        UnityPrintLen(expected, length);
        UNITY_OUTPUT_CHAR('\'');
    }
    else
    {
      UnityPrint(UnityStrNull);
    }
    UnityPrint(UnityStrWas);
    if (actual != NULL)
    {
        UNITY_OUTPUT_CHAR('\'');
        UnityPrintLen(actual, length);
        UNITY_OUTPUT_CHAR('\'');
    }
    else
    {
      UnityPrint(UnityStrNull);
    }
}



//-----------------------------------------------
// Assertion & Control Helpers
//-----------------------------------------------

static int UnityCheckArraysForNull(UNITY_PTR_ATTRIBUTE const void* expected, UNITY_PTR_ATTRIBUTE const void* actual, const UNITY_LINE_TYPE lineNumber, const char* msg)
{
    //return true if they are both NULL
    if ((expected == NULL) && (actual == NULL))
        return 1;

    //throw error if just expected is NULL
    if (expected == NULL)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrNullPointerForExpected);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    //throw error if just actual is NULL
    if (actual == NULL)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrNullPointerForActual);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    //return false if neither is NULL
    return 0;
}

//-----------------------------------------------
// Assertion Functions
//-----------------------------------------------

void UnityAssertBits(const _U_SINT mask,
                     const _U_SINT expected,
                     const _U_SINT actual,
                     const char* msg,
                     const UNITY_LINE_TYPE lineNumber)
{
    UNITY_SKIP_EXECUTION;

    if ((mask & expected) != (mask & actual))
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrExpected);
        UnityPrintMask((_U_UINT)mask, (_U_UINT)expected);
        UnityPrint(UnityStrWas);
        UnityPrintMask((_U_UINT)mask, (_U_UINT)actual);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------
void UnityAssertEqualNumber(const _U_SINT expected,
                            const _U_SINT actual,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber,
                            const UNITY_DISPLAY_STYLE_T style)
{
    UNITY_SKIP_EXECUTION;

    if (expected != actual)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrExpected);
        UnityPrintNumberByStyle(expected, style);
        UnityPrint(UnityStrWas);
        UnityPrintNumberByStyle(actual, style);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------
void UnityAssertEqualIntArray(UNITY_PTR_ATTRIBUTE const void* expected,
                              UNITY_PTR_ATTRIBUTE const void* actual,
                              const _UU32 num_elements,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber,
                              const UNITY_DISPLAY_STYLE_T style)
{
    _UU32 elements = num_elements;
    UNITY_PTR_ATTRIBUTE const void* ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)expected;
    UNITY_PTR_ATTRIBUTE const void* ptr_act = (UNITY_PTR_ATTRIBUTE const void*)actual;

    UNITY_SKIP_EXECUTION;

    if (elements == 0)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrPointless);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    if (UnityCheckArraysForNull((UNITY_PTR_ATTRIBUTE const void*)expected, (UNITY_PTR_ATTRIBUTE const void*)actual, lineNumber, msg) == 1)
        return;

    // If style is UNITY_DISPLAY_STYLE_INT, we'll fall into the default case rather than the INT16 or INT32 (etc) case
    // as UNITY_DISPLAY_STYLE_INT includes a flag for UNITY_DISPLAY_RANGE_AUTO, which the width-specific
    // variants do not. Therefore remove this flag.
    switch(style & (UNITY_DISPLAY_STYLE_T)(~UNITY_DISPLAY_RANGE_AUTO))
    {
        case UNITY_DISPLAY_STYLE_HEX8:
        case UNITY_DISPLAY_STYLE_INT8:
        case UNITY_DISPLAY_STYLE_UINT8:
            while (elements--)
            {
                if (*(UNITY_PTR_ATTRIBUTE const _US8*)ptr_exp != *(UNITY_PTR_ATTRIBUTE const _US8*)ptr_act)
                {
                    UnityTestResultsFailBegin(lineNumber);
                    UnityPrint(UnityStrElement);
                    UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
                    UnityPrint(UnityStrExpected);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US8*)ptr_exp, style);
                    UnityPrint(UnityStrWas);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US8*)ptr_act, style);
                    UnityAddMsgIfSpecified(msg);
                    UNITY_FAIL_AND_BAIL;
                }
                ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_exp + 1);
                ptr_act = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_act + 1);
            }
            break;
        case UNITY_DISPLAY_STYLE_HEX16:
        case UNITY_DISPLAY_STYLE_INT16:
        case UNITY_DISPLAY_STYLE_UINT16:
            while (elements--)
            {
                if (*(UNITY_PTR_ATTRIBUTE const _US16*)ptr_exp != *(UNITY_PTR_ATTRIBUTE const _US16*)ptr_act)
                {
                    UnityTestResultsFailBegin(lineNumber);
                    UnityPrint(UnityStrElement);
                    UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
                    UnityPrint(UnityStrExpected);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US16*)ptr_exp, style);
                    UnityPrint(UnityStrWas);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US16*)ptr_act, style);
                    UnityAddMsgIfSpecified(msg);
                    UNITY_FAIL_AND_BAIL;
                }
                ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_exp + 2);
                ptr_act = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_act + 2);
            }
            break;
#ifdef UNITY_SUPPORT_64
        case UNITY_DISPLAY_STYLE_HEX64:
        case UNITY_DISPLAY_STYLE_INT64:
        case UNITY_DISPLAY_STYLE_UINT64:
            while (elements--)
            {
                if (*(UNITY_PTR_ATTRIBUTE const _US64*)ptr_exp != *(UNITY_PTR_ATTRIBUTE const _US64*)ptr_act)
                {
                    UnityTestResultsFailBegin(lineNumber);
                    UnityPrint(UnityStrElement);
                    UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
                    UnityPrint(UnityStrExpected);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US64*)ptr_exp, style);
                    UnityPrint(UnityStrWas);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US64*)ptr_act, style);
                    UnityAddMsgIfSpecified(msg);
                    UNITY_FAIL_AND_BAIL;
                }
                ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_exp + 8);
                ptr_act = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_act + 8);
            }
            break;
#endif
        default:
            while (elements--)
            {
                if (*(UNITY_PTR_ATTRIBUTE const _US32*)ptr_exp != *(UNITY_PTR_ATTRIBUTE const _US32*)ptr_act)
                {
                    UnityTestResultsFailBegin(lineNumber);
                    UnityPrint(UnityStrElement);
                    UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
                    UnityPrint(UnityStrExpected);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US32*)ptr_exp, style);
                    UnityPrint(UnityStrWas);
                    UnityPrintNumberByStyle(*(UNITY_PTR_ATTRIBUTE const _US32*)ptr_act, style);
                    UnityAddMsgIfSpecified(msg);
                    UNITY_FAIL_AND_BAIL;
                }
                ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_exp + 4);
                ptr_act = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_act + 4);
            }
            break;
    }
}

//-----------------------------------------------
#ifndef UNITY_EXCLUDE_FLOAT
void UnityAssertEqualFloatArray(UNITY_PTR_ATTRIBUTE const _UF* expected,
                                UNITY_PTR_ATTRIBUTE const _UF* actual,
                                const _UU32 num_elements,
                                const char* msg,
                                const UNITY_LINE_TYPE lineNumber)
{
    _UU32 elements = num_elements;
    UNITY_PTR_ATTRIBUTE const _UF* ptr_expected = expected;
    UNITY_PTR_ATTRIBUTE const _UF* ptr_actual = actual;
    _UF diff, tol;

    UNITY_SKIP_EXECUTION;

    if (elements == 0)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrPointless);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    if (UnityCheckArraysForNull((UNITY_PTR_ATTRIBUTE const void*)expected, (UNITY_PTR_ATTRIBUTE const void*)actual, lineNumber, msg) == 1)
        return;

    while (elements--)
    {
        diff = *ptr_expected - *ptr_actual;
        if (diff < 0.0f)
          diff = 0.0f - diff;
        tol = UNITY_FLOAT_PRECISION * *ptr_expected;
        if (tol < 0.0f)
            tol = 0.0f - tol;

        //This first part of this condition will catch any NaN or Infinite values
        if ((diff * 0.0f != 0.0f) || (diff > tol))
        {
            UnityTestResultsFailBegin(lineNumber);
            UnityPrint(UnityStrElement);
            UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
#ifdef UNITY_FLOAT_VERBOSE
            UnityPrint(UnityStrExpected);
            UnityPrintFloat(*ptr_expected);
            UnityPrint(UnityStrWas);
            UnityPrintFloat(*ptr_actual);
#else
            UnityPrint(UnityStrDelta);
#endif
            UnityAddMsgIfSpecified(msg);
            UNITY_FAIL_AND_BAIL;
        }
        ptr_expected++;
        ptr_actual++;
    }
}

//-----------------------------------------------
void UnityAssertFloatsWithin(const _UF delta,
                             const _UF expected,
                             const _UF actual,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber)
{
    _UF diff = actual - expected;
    _UF pos_delta = delta;

    UNITY_SKIP_EXECUTION;

    if (diff < 0.0f)
    {
        diff = 0.0f - diff;
    }
    if (pos_delta < 0.0f)
    {
        pos_delta = 0.0f - pos_delta;
    }

    //This first part of this condition will catch any NaN or Infinite values
    if ((diff * 0.0f != 0.0f) || (pos_delta < diff))
    {
        UnityTestResultsFailBegin(lineNumber);
#ifdef UNITY_FLOAT_VERBOSE
        UnityPrint(UnityStrExpected);
        UnityPrintFloat(expected);
        UnityPrint(UnityStrWas);
        UnityPrintFloat(actual);
#else
        UnityPrint(UnityStrDelta);
#endif
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------
void UnityAssertFloatSpecial(const _UF actual,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber,
                             const UNITY_FLOAT_TRAIT_T style)
{
    const char* trait_names[] = { UnityStrInf, UnityStrNegInf, UnityStrNaN, UnityStrDet };
    _U_SINT should_be_trait   = ((_U_SINT)style & 1);
    _U_SINT is_trait          = !should_be_trait;
    _U_SINT trait_index       = style >> 1;

    UNITY_SKIP_EXECUTION;

    switch(style)
    {
        //To determine Inf / Neg Inf, we compare to an Inf / Neg Inf value we create on the fly
        //We are using a variable to hold the zero value because some compilers complain about dividing by zero otherwise
        case UNITY_FLOAT_IS_INF:
        case UNITY_FLOAT_IS_NOT_INF:
            is_trait = ((1.0f / f_zero) == actual) ? 1 : 0;
            break;
        case UNITY_FLOAT_IS_NEG_INF:
        case UNITY_FLOAT_IS_NOT_NEG_INF:
            is_trait = ((-1.0f / f_zero) == actual) ? 1 : 0;
            break;

        //NaN is the only floating point value that does NOT equal itself. Therefore if Actual == Actual, then it is NOT NaN.
        case UNITY_FLOAT_IS_NAN:
        case UNITY_FLOAT_IS_NOT_NAN:
            is_trait = (actual == actual) ? 0 : 1;
            break;

        //A determinate number is non infinite and not NaN. (therefore the opposite of the two above)
        case UNITY_FLOAT_IS_DET:
        case UNITY_FLOAT_IS_NOT_DET:
            if ( (actual != actual) || ((1.0f / f_zero) == actual) || ((-1.0f / f_zero) == actual) )
                is_trait = 0;
            else
                is_trait = 1;
            break;
	default:
	    ;
    }

    if (is_trait != should_be_trait)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrExpected);
        if (!should_be_trait)
            UnityPrint(UnityStrNot);
        UnityPrint(trait_names[trait_index]);
        UnityPrint(UnityStrWas);
#ifdef UNITY_FLOAT_VERBOSE
        UnityPrintFloat(actual);
#else
        if (should_be_trait)
            UnityPrint(UnityStrNot);
        UnityPrint(trait_names[trait_index]);
#endif
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

#endif //not UNITY_EXCLUDE_FLOAT

//-----------------------------------------------
#ifndef UNITY_EXCLUDE_DOUBLE
void UnityAssertEqualDoubleArray(UNITY_PTR_ATTRIBUTE const _UD* expected,
                                 UNITY_PTR_ATTRIBUTE const _UD* actual,
                                 const _UU32 num_elements,
                                 const char* msg,
                                 const UNITY_LINE_TYPE lineNumber)
{
    _UU32 elements = num_elements;
    UNITY_PTR_ATTRIBUTE const _UD* ptr_expected = expected;
    UNITY_PTR_ATTRIBUTE const _UD* ptr_actual = actual;
    _UD diff, tol;

    UNITY_SKIP_EXECUTION;

    if (elements == 0)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrPointless);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    if (UnityCheckArraysForNull((UNITY_PTR_ATTRIBUTE void*)expected, (UNITY_PTR_ATTRIBUTE void*)actual, lineNumber, msg) == 1)
        return;

    while (elements--)
    {
        diff = *ptr_expected - *ptr_actual;
        if (diff < 0.0)
          diff = 0.0 - diff;
        tol = UNITY_DOUBLE_PRECISION * *ptr_expected;
        if (tol < 0.0)
            tol = 0.0 - tol;

        //This first part of this condition will catch any NaN or Infinite values
        if ((diff * 0.0 != 0.0) || (diff > tol))
        {
            UnityTestResultsFailBegin(lineNumber);
            UnityPrint(UnityStrElement);
            UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
#ifdef UNITY_DOUBLE_VERBOSE
            UnityPrint(UnityStrExpected);
            UnityPrintFloat((float)(*ptr_expected));
            UnityPrint(UnityStrWas);
            UnityPrintFloat((float)(*ptr_actual));
#else
            UnityPrint(UnityStrDelta);
#endif
            UnityAddMsgIfSpecified(msg);
            UNITY_FAIL_AND_BAIL;
        }
        ptr_expected++;
        ptr_actual++;
    }
}

//-----------------------------------------------
void UnityAssertDoublesWithin(const _UD delta,
                              const _UD expected,
                              const _UD actual,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber)
{
    _UD diff = actual - expected;
    _UD pos_delta = delta;

    UNITY_SKIP_EXECUTION;

    if (diff < 0.0)
    {
        diff = 0.0 - diff;
    }
    if (pos_delta < 0.0)
    {
        pos_delta = 0.0 - pos_delta;
    }

    //This first part of this condition will catch any NaN or Infinite values
    if ((diff * 0.0 != 0.0) || (pos_delta < diff))
    {
        UnityTestResultsFailBegin(lineNumber);
#ifdef UNITY_DOUBLE_VERBOSE
        UnityPrint(UnityStrExpected);
        UnityPrintFloat((float)expected);
        UnityPrint(UnityStrWas);
        UnityPrintFloat((float)actual);
#else
        UnityPrint(UnityStrDelta);
#endif
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------

void UnityAssertDoubleSpecial(const _UD actual,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber,
                              const UNITY_FLOAT_TRAIT_T style)
{
    const char* trait_names[] = { UnityStrInf, UnityStrNegInf, UnityStrNaN, UnityStrDet };
    _U_SINT should_be_trait   = ((_U_SINT)style & 1);
    _U_SINT is_trait          = !should_be_trait;
    _U_SINT trait_index       = style >> 1;

    UNITY_SKIP_EXECUTION;

    switch(style)
    {
        //To determine Inf / Neg Inf, we compare to an Inf / Neg Inf value we create on the fly
        //We are using a variable to hold the zero value because some compilers complain about dividing by zero otherwise
        case UNITY_FLOAT_IS_INF:
        case UNITY_FLOAT_IS_NOT_INF:
            is_trait = ((1.0 / d_zero) == actual) ? 1 : 0;
            break;
        case UNITY_FLOAT_IS_NEG_INF:
        case UNITY_FLOAT_IS_NOT_NEG_INF:
            is_trait = ((-1.0 / d_zero) == actual) ? 1 : 0;
            break;

        //NaN is the only floating point value that does NOT equal itself. Therefore if Actual == Actual, then it is NOT NaN.
        case UNITY_FLOAT_IS_NAN:
        case UNITY_FLOAT_IS_NOT_NAN:
            is_trait = (actual == actual) ? 0 : 1;
            break;

        //A determinate number is non infinite and not NaN. (therefore the opposite of the two above)
        case UNITY_FLOAT_IS_DET:
        case UNITY_FLOAT_IS_NOT_DET:
            if ( (actual != actual) || ((1.0 / d_zero) == actual) || ((-1.0 / d_zero) == actual) )
                is_trait = 0;
            else
                is_trait = 1;
            break;
	default:
	    ;
    }

    if (is_trait != should_be_trait)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrExpected);
        if (!should_be_trait)
            UnityPrint(UnityStrNot);
        UnityPrint(trait_names[trait_index]);
        UnityPrint(UnityStrWas);
#ifdef UNITY_DOUBLE_VERBOSE
        UnityPrintFloat(actual);
#else
        if (should_be_trait)
            UnityPrint(UnityStrNot);
        UnityPrint(trait_names[trait_index]);
#endif
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}


#endif // not UNITY_EXCLUDE_DOUBLE

//-----------------------------------------------
void UnityAssertNumbersWithin( const _U_SINT delta,
                               const _U_SINT expected,
                               const _U_SINT actual,
                               const char* msg,
                               const UNITY_LINE_TYPE lineNumber,
                               const UNITY_DISPLAY_STYLE_T style)
{
    UNITY_SKIP_EXECUTION;

    if ((style & UNITY_DISPLAY_RANGE_INT) == UNITY_DISPLAY_RANGE_INT)
    {
        if (actual > expected)
          Unity.CurrentTestFailed = ((actual - expected) > delta);
        else
          Unity.CurrentTestFailed = ((expected - actual) > delta);
    }
    else
    {
        if ((_U_UINT)actual > (_U_UINT)expected)
            Unity.CurrentTestFailed = ((_U_UINT)(actual - expected) > (_U_UINT)delta);
        else
            Unity.CurrentTestFailed = ((_U_UINT)(expected - actual) > (_U_UINT)delta);
    }

    if (Unity.CurrentTestFailed)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrDelta);
        UnityPrintNumberByStyle(delta, style);
        UnityPrint(UnityStrExpected);
        UnityPrintNumberByStyle(expected, style);
        UnityPrint(UnityStrWas);
        UnityPrintNumberByStyle(actual, style);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------
void UnityAssertEqualString(const char* expected,
                            const char* actual,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber)
{
    _UU32 i;

    UNITY_SKIP_EXECUTION;

    // if both pointers not null compare the strings
    if (expected && actual)
    {
        for (i = 0; expected[i] || actual[i]; i++)
        {
            if (expected[i] != actual[i])
            {
                Unity.CurrentTestFailed = 1;
                break;
            }
        }
    }
    else
    { // handle case of one pointers being null (if both null, test should pass)
        if (expected != actual)
        {
            Unity.CurrentTestFailed = 1;
        }
    }

    if (Unity.CurrentTestFailed)
    {
      UnityTestResultsFailBegin(lineNumber);
      UnityPrintExpectedAndActualStrings(expected, actual);
      UnityAddMsgIfSpecified(msg);
      UNITY_FAIL_AND_BAIL;
    }
}

//-----------------------------------------------
void UnityAssertEqualStringLen(const char* expected,
                            const char* actual,
                            const _UU32 length,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber)
{
    _UU32 i;

    UNITY_SKIP_EXECUTION;

    // if both pointers not null compare the strings
    if (expected && actual)
    {
        for (i = 0; (expected[i] || actual[i]) && i < length; i++)
        {
            if (expected[i] != actual[i])
            {
                Unity.CurrentTestFailed = 1;
                break;
            }
        }
    }
    else
    { // handle case of one pointers being null (if both null, test should pass)
        if (expected != actual)
        {
            Unity.CurrentTestFailed = 1;
        }
    }

    if (Unity.CurrentTestFailed)
    {
      UnityTestResultsFailBegin(lineNumber);
      UnityPrintExpectedAndActualStringsLen(expected, actual, length);
      UnityAddMsgIfSpecified(msg);
      UNITY_FAIL_AND_BAIL;
    }
}


//-----------------------------------------------
void UnityAssertEqualStringArray( const char** expected,
                                  const char** actual,
                                  const _UU32 num_elements,
                                  const char* msg,
                                  const UNITY_LINE_TYPE lineNumber)
{
    _UU32 i, j = 0;

    UNITY_SKIP_EXECUTION;

    // if no elements, it's an error
    if (num_elements == 0)
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrPointless);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    if (UnityCheckArraysForNull((UNITY_PTR_ATTRIBUTE void*)expected, (UNITY_PTR_ATTRIBUTE void*)actual, lineNumber, msg) == 1)
        return;

    do
    {
        // if both pointers not null compare the strings
        if (expected[j] && actual[j])
        {
            for (i = 0; expected[j][i] || actual[j][i]; i++)
            {
                if (expected[j][i] != actual[j][i])
                {
                    Unity.CurrentTestFailed = 1;
                    break;
                }
            }
        }
        else
        { // handle case of one pointers being null (if both null, test should pass)
            if (expected[j] != actual[j])
            {
                Unity.CurrentTestFailed = 1;
            }
        }

        if (Unity.CurrentTestFailed)
        {
            UnityTestResultsFailBegin(lineNumber);
            if (num_elements > 1)
            {
                UnityPrint(UnityStrElement);
                UnityPrintNumberByStyle((j), UNITY_DISPLAY_STYLE_UINT);
            }
            UnityPrintExpectedAndActualStrings((const char*)(expected[j]), (const char*)(actual[j]));
            UnityAddMsgIfSpecified(msg);
            UNITY_FAIL_AND_BAIL;
        }
    } while (++j < num_elements);
}

//-----------------------------------------------
void UnityAssertEqualMemory( UNITY_PTR_ATTRIBUTE const void* expected,
                             UNITY_PTR_ATTRIBUTE const void* actual,
                             const _UU32 length,
                             const _UU32 num_elements,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber)
{
    UNITY_PTR_ATTRIBUTE const unsigned char* ptr_exp = (UNITY_PTR_ATTRIBUTE const unsigned char*)expected;
    UNITY_PTR_ATTRIBUTE const unsigned char* ptr_act = (UNITY_PTR_ATTRIBUTE const unsigned char*)actual;
    _UU32 elements = num_elements;
    _UU32 bytes;

    UNITY_SKIP_EXECUTION;

    if ((elements == 0) || (length == 0))
    {
        UnityTestResultsFailBegin(lineNumber);
        UnityPrint(UnityStrPointless);
        UnityAddMsgIfSpecified(msg);
        UNITY_FAIL_AND_BAIL;
    }

    if (UnityCheckArraysForNull((UNITY_PTR_ATTRIBUTE const void*)expected, (UNITY_PTR_ATTRIBUTE const void*)actual, lineNumber, msg) == 1)
        return;

    while (elements--)
    {
        /////////////////////////////////////
        bytes = length;
        while (bytes--)
        {
            if (*ptr_exp != *ptr_act)
            {
                UnityTestResultsFailBegin(lineNumber);
                UnityPrint(UnityStrMemory);
                if (num_elements > 1)
                {
                    UnityPrint(UnityStrElement);
                    UnityPrintNumberByStyle((num_elements - elements - 1), UNITY_DISPLAY_STYLE_UINT);
                }
                UnityPrint(UnityStrByte);
                UnityPrintNumberByStyle((length - bytes - 1), UNITY_DISPLAY_STYLE_UINT);
                UnityPrint(UnityStrExpected);
                UnityPrintNumberByStyle(*ptr_exp, UNITY_DISPLAY_STYLE_HEX8);
                UnityPrint(UnityStrWas);
                UnityPrintNumberByStyle(*ptr_act, UNITY_DISPLAY_STYLE_HEX8);
                UnityAddMsgIfSpecified(msg);
                UNITY_FAIL_AND_BAIL;
            }
            ptr_exp = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_exp + 1);
            ptr_act = (UNITY_PTR_ATTRIBUTE const void*)((_UP)ptr_act + 1);
        }
        /////////////////////////////////////

    }
}

//-----------------------------------------------
// Control Functions
//-----------------------------------------------

void UnityFail(const char* msg, const UNITY_LINE_TYPE line)
{
    UNITY_SKIP_EXECUTION;

    UnityTestResultsBegin(Unity.TestFile, line);
    UnityPrintFail();
    if (msg != NULL)
    {
      UNITY_OUTPUT_CHAR(':');
      if (msg[0] != ' ')
      {
        UNITY_OUTPUT_CHAR(' ');
      }
      UnityPrint(msg);
    }
    UNITY_FAIL_AND_BAIL;
}

//-----------------------------------------------
void UnityIgnore(const char* msg, const UNITY_LINE_TYPE line)
{
    UNITY_SKIP_EXECUTION;

    UnityTestResultsBegin(Unity.TestFile, line);
    UnityPrint(UnityStrIgnore);
    if (msg != NULL)
    {
      UNITY_OUTPUT_CHAR(':');
      UNITY_OUTPUT_CHAR(' ');
      UnityPrint(msg);
    }
    UNITY_IGNORE_AND_BAIL;
}

//-----------------------------------------------
#if defined(UNITY_WEAK_ATTRIBUTE)
    void setUp(void);
    void tearDown(void);
    UNITY_WEAK_ATTRIBUTE void setUp(void) { }
    UNITY_WEAK_ATTRIBUTE void tearDown(void) { }
#elif defined(UNITY_WEAK_PRAGMA)
#   pragma weak setUp
    void setUp(void);
#   pragma weak tearDown
    void tearDown(void);
#else
    void setUp(void);
    void tearDown(void);
#endif
//-----------------------------------------------
void UnityDefaultTestRun(UnityTestFunction Func, const char* FuncName, const int FuncLineNum)
{
    Unity.CurrentTestName = FuncName;
    Unity.CurrentTestLineNumber = (UNITY_LINE_TYPE)FuncLineNum;
    Unity.NumberOfTests++;
    if (TEST_PROTECT())
    {
        setUp();
        Func();
    }
    if (TEST_PROTECT() && !(Unity.CurrentTestIgnored))
    {
        tearDown();
    }
    UnityConcludeTest();
}

//-----------------------------------------------
void UnityBegin(const char* filename)
{
    Unity.TestFile = filename;
    Unity.CurrentTestName = NULL;
    Unity.CurrentTestLineNumber = 0;
    Unity.NumberOfTests = 0;
    Unity.TestFailures = 0;
    Unity.TestIgnores = 0;
    Unity.CurrentTestFailed = 0;
    Unity.CurrentTestIgnored = 0;

    UNITY_OUTPUT_START();
}

//-----------------------------------------------
int UnityEnd(void)
{
    UNITY_PRINT_EOL;
    UnityPrint(UnityStrBreaker);
    UNITY_PRINT_EOL;
    UnityPrintNumber((_U_SINT)(Unity.NumberOfTests));
    UnityPrint(UnityStrResultsTests);
    UnityPrintNumber((_U_SINT)(Unity.TestFailures));
    UnityPrint(UnityStrResultsFailures);
    UnityPrintNumber((_U_SINT)(Unity.TestIgnores));
    UnityPrint(UnityStrResultsIgnored);
    UNITY_PRINT_EOL;
    if (Unity.TestFailures == 0U)
    {
        UnityPrintOk();
    }
    else
    {
        UnityPrintFail();
    }
    UNITY_PRINT_EOL;
    UNITY_OUTPUT_COMPLETE();
    return (int)(Unity.TestFailures);
}

//-----------------------------------------------

test/vendor/unity.h

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
/* ==========================================
    Unity Project - A Test Framework for C
    Copyright (c) 2007-14 Mike Karlesky, Mark VanderVoord, Greg Williams
    [Released under MIT License. Please refer to license.txt for details]
========================================== */

#ifndef UNITY_FRAMEWORK_H
#define UNITY_FRAMEWORK_H
#define UNITY

#include "unity_internals.h"

//-------------------------------------------------------
// Configuration Options
//-------------------------------------------------------
// All options described below should be passed as a compiler flag to all files using Unity. If you must add #defines, place them BEFORE the #include above.

// Integers/longs/pointers
//     - Unity attempts to automatically discover your integer sizes
//       - define UNITY_EXCLUDE_STDINT_H to stop attempting to look in <stdint.h>
//       - define UNITY_EXCLUDE_LIMITS_H to stop attempting to look in <limits.h>
//       - define UNITY_EXCLUDE_SIZEOF to stop attempting to use sizeof in macros
//     - If you cannot use the automatic methods above, you can force Unity by using these options:
//       - define UNITY_SUPPORT_64
//       - define UNITY_INT_WIDTH
//       - UNITY_LONG_WIDTH
//       - UNITY_POINTER_WIDTH

// Floats
//     - define UNITY_EXCLUDE_FLOAT to disallow floating point comparisons
//     - define UNITY_FLOAT_PRECISION to specify the precision to use when doing TEST_ASSERT_EQUAL_FLOAT
//     - define UNITY_FLOAT_TYPE to specify doubles instead of single precision floats
//     - define UNITY_FLOAT_VERBOSE to print floating point values in errors (uses sprintf)
//     - define UNITY_INCLUDE_DOUBLE to allow double floating point comparisons
//     - define UNITY_EXCLUDE_DOUBLE to disallow double floating point comparisons (default)
//     - define UNITY_DOUBLE_PRECISION to specify the precision to use when doing TEST_ASSERT_EQUAL_DOUBLE
//     - define UNITY_DOUBLE_TYPE to specify something other than double
//     - define UNITY_DOUBLE_VERBOSE to print floating point values in errors (uses sprintf)

// Output
//     - by default, Unity prints to standard out with putchar.  define UNITY_OUTPUT_CHAR(a) with a different function if desired

// Optimization
//     - by default, line numbers are stored in unsigned shorts.  Define UNITY_LINE_TYPE with a different type if your files are huge
//     - by default, test and failure counters are unsigned shorts.  Define UNITY_COUNTER_TYPE with a different type if you want to save space or have more than 65535 Tests.

// Test Cases
//     - define UNITY_SUPPORT_TEST_CASES to include the TEST_CASE macro, though really it's mostly about the runner generator script

// Parameterized Tests
//     - you'll want to create a define of TEST_CASE(...) which basically evaluates to nothing

//-------------------------------------------------------
// Basic Fail and Ignore
//-------------------------------------------------------

#define TEST_FAIL_MESSAGE(message)                                                                 UNITY_TEST_FAIL(__LINE__, message)
#define TEST_FAIL()                                                                                UNITY_TEST_FAIL(__LINE__, NULL)
#define TEST_IGNORE_MESSAGE(message)                                                               UNITY_TEST_IGNORE(__LINE__, message)
#define TEST_IGNORE()                                                                              UNITY_TEST_IGNORE(__LINE__, NULL)
#define TEST_ONLY()

//-------------------------------------------------------
// Test Asserts (simple)
//-------------------------------------------------------

//Boolean
#define TEST_ASSERT(condition)                                                                     UNITY_TEST_ASSERT(       (condition), __LINE__, " Expression Evaluated To FALSE")
#define TEST_ASSERT_TRUE(condition)                                                                UNITY_TEST_ASSERT(       (condition), __LINE__, " Expected TRUE Was FALSE")
#define TEST_ASSERT_UNLESS(condition)                                                              UNITY_TEST_ASSERT(      !(condition), __LINE__, " Expression Evaluated To TRUE")
#define TEST_ASSERT_FALSE(condition)                                                               UNITY_TEST_ASSERT(      !(condition), __LINE__, " Expected FALSE Was TRUE")
#define TEST_ASSERT_NULL(pointer)                                                                  UNITY_TEST_ASSERT_NULL(    (pointer), __LINE__, " Expected NULL")
#define TEST_ASSERT_NOT_NULL(pointer)                                                              UNITY_TEST_ASSERT_NOT_NULL((pointer), __LINE__, " Expected Non-NULL")

//Integers (of all sizes)
#define TEST_ASSERT_EQUAL_INT(expected, actual)                                                    UNITY_TEST_ASSERT_EQUAL_INT((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT8(expected, actual)                                                   UNITY_TEST_ASSERT_EQUAL_INT8((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT16(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_INT16((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT32(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_INT32((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT64(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_INT64((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL(expected, actual)                                                        UNITY_TEST_ASSERT_EQUAL_INT((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_NOT_EQUAL(expected, actual)                                                    UNITY_TEST_ASSERT(((expected) !=  (actual)), __LINE__, " Expected Not-Equal")
#define TEST_ASSERT_EQUAL_UINT(expected, actual)                                                   UNITY_TEST_ASSERT_EQUAL_UINT( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT8(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_UINT8( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT16(expected, actual)                                                 UNITY_TEST_ASSERT_EQUAL_UINT16( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT32(expected, actual)                                                 UNITY_TEST_ASSERT_EQUAL_UINT32( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT64(expected, actual)                                                 UNITY_TEST_ASSERT_EQUAL_UINT64( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX(expected, actual)                                                    UNITY_TEST_ASSERT_EQUAL_HEX32((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX8(expected, actual)                                                   UNITY_TEST_ASSERT_EQUAL_HEX8( (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX16(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_HEX16((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX32(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_HEX32((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX64(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_HEX64((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_BITS(mask, expected, actual)                                                   UNITY_TEST_ASSERT_BITS((mask), (expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_BITS_HIGH(mask, actual)                                                        UNITY_TEST_ASSERT_BITS((mask), (_UU32)(-1), (actual), __LINE__, NULL)
#define TEST_ASSERT_BITS_LOW(mask, actual)                                                         UNITY_TEST_ASSERT_BITS((mask), (_UU32)(0), (actual), __LINE__, NULL)
#define TEST_ASSERT_BIT_HIGH(bit, actual)                                                          UNITY_TEST_ASSERT_BITS(((_UU32)1 << bit), (_UU32)(-1), (actual), __LINE__, NULL)
#define TEST_ASSERT_BIT_LOW(bit, actual)                                                           UNITY_TEST_ASSERT_BITS(((_UU32)1 << bit), (_UU32)(0), (actual), __LINE__, NULL)

//Integer Ranges (of all sizes)
#define TEST_ASSERT_INT_WITHIN(delta, expected, actual)                                            UNITY_TEST_ASSERT_INT_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_INT8_WITHIN(delta, expected, actual)                                           UNITY_TEST_ASSERT_INT8_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_INT16_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_INT16_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_INT32_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_INT32_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_INT64_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_INT64_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_UINT_WITHIN(delta, expected, actual)                                           UNITY_TEST_ASSERT_UINT_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_UINT8_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_UINT8_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_UINT16_WITHIN(delta, expected, actual)                                         UNITY_TEST_ASSERT_UINT16_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_UINT32_WITHIN(delta, expected, actual)                                         UNITY_TEST_ASSERT_UINT32_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_UINT64_WITHIN(delta, expected, actual)                                         UNITY_TEST_ASSERT_UINT64_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_HEX_WITHIN(delta, expected, actual)                                            UNITY_TEST_ASSERT_HEX32_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_HEX8_WITHIN(delta, expected, actual)                                           UNITY_TEST_ASSERT_HEX8_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_HEX16_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_HEX16_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_HEX32_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_HEX32_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_HEX64_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_HEX64_WITHIN(delta, expected, actual, __LINE__, NULL)

//Structs and Strings
#define TEST_ASSERT_EQUAL_PTR(expected, actual)                                                    UNITY_TEST_ASSERT_EQUAL_PTR((expected), (actual), __LINE__, NULL)
#define TEST_ASSERT_EQUAL_STRING(expected, actual)                                                 UNITY_TEST_ASSERT_EQUAL_STRING(expected, actual, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_STRING_LEN(expected, actual, len)                                        UNITY_TEST_ASSERT_EQUAL_STRING_LEN(expected, actual, len, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_MEMORY(expected, actual, len)                                            UNITY_TEST_ASSERT_EQUAL_MEMORY(expected, actual, len, __LINE__, NULL)

//Arrays
#define TEST_ASSERT_EQUAL_INT_ARRAY(expected, actual, num_elements)                                UNITY_TEST_ASSERT_EQUAL_INT_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT8_ARRAY(expected, actual, num_elements)                               UNITY_TEST_ASSERT_EQUAL_INT8_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT16_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_INT16_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT32_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_INT32_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_INT64_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_INT64_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT_ARRAY(expected, actual, num_elements)                               UNITY_TEST_ASSERT_EQUAL_UINT_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT8_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_UINT8_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT16_ARRAY(expected, actual, num_elements)                             UNITY_TEST_ASSERT_EQUAL_UINT16_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT32_ARRAY(expected, actual, num_elements)                             UNITY_TEST_ASSERT_EQUAL_UINT32_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_UINT64_ARRAY(expected, actual, num_elements)                             UNITY_TEST_ASSERT_EQUAL_UINT64_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX_ARRAY(expected, actual, num_elements)                                UNITY_TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX8_ARRAY(expected, actual, num_elements)                               UNITY_TEST_ASSERT_EQUAL_HEX8_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX16_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_HEX16_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_HEX64_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_HEX64_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_PTR_ARRAY(expected, actual, num_elements)                                UNITY_TEST_ASSERT_EQUAL_PTR_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_STRING_ARRAY(expected, actual, num_elements)                             UNITY_TEST_ASSERT_EQUAL_STRING_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_MEMORY_ARRAY(expected, actual, len, num_elements)                        UNITY_TEST_ASSERT_EQUAL_MEMORY_ARRAY(expected, actual, len, num_elements, __LINE__, NULL)

//Floating Point (If Enabled)
#define TEST_ASSERT_FLOAT_WITHIN(delta, expected, actual)                                          UNITY_TEST_ASSERT_FLOAT_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_FLOAT(expected, actual)                                                  UNITY_TEST_ASSERT_EQUAL_FLOAT(expected, actual, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_FLOAT_ARRAY(expected, actual, num_elements)                              UNITY_TEST_ASSERT_EQUAL_FLOAT_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_INF(actual)                                                           UNITY_TEST_ASSERT_FLOAT_IS_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NEG_INF(actual)                                                       UNITY_TEST_ASSERT_FLOAT_IS_NEG_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NAN(actual)                                                           UNITY_TEST_ASSERT_FLOAT_IS_NAN(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_DETERMINATE(actual)                                                   UNITY_TEST_ASSERT_FLOAT_IS_DETERMINATE(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NOT_INF(actual)                                                       UNITY_TEST_ASSERT_FLOAT_IS_NOT_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NOT_NEG_INF(actual)                                                   UNITY_TEST_ASSERT_FLOAT_IS_NOT_NEG_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NOT_NAN(actual)                                                       UNITY_TEST_ASSERT_FLOAT_IS_NOT_NAN(actual, __LINE__, NULL)
#define TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE(actual)                                               UNITY_TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE(actual, __LINE__, NULL)

//Double (If Enabled)
#define TEST_ASSERT_DOUBLE_WITHIN(delta, expected, actual)                                         UNITY_TEST_ASSERT_DOUBLE_WITHIN(delta, expected, actual, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_DOUBLE(expected, actual)                                                 UNITY_TEST_ASSERT_EQUAL_DOUBLE(expected, actual, __LINE__, NULL)
#define TEST_ASSERT_EQUAL_DOUBLE_ARRAY(expected, actual, num_elements)                             UNITY_TEST_ASSERT_EQUAL_DOUBLE_ARRAY(expected, actual, num_elements, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_INF(actual)                                                          UNITY_TEST_ASSERT_DOUBLE_IS_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NEG_INF(actual)                                                      UNITY_TEST_ASSERT_DOUBLE_IS_NEG_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NAN(actual)                                                          UNITY_TEST_ASSERT_DOUBLE_IS_NAN(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_DETERMINATE(actual)                                                  UNITY_TEST_ASSERT_DOUBLE_IS_DETERMINATE(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NOT_INF(actual)                                                      UNITY_TEST_ASSERT_DOUBLE_IS_NOT_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF(actual)                                                  UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NOT_NAN(actual)                                                      UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NAN(actual, __LINE__, NULL)
#define TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE(actual)                                              UNITY_TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE(actual, __LINE__, NULL)

//-------------------------------------------------------
// Test Asserts (with additional messages)
//-------------------------------------------------------

//Boolean
#define TEST_ASSERT_MESSAGE(condition, message)                                                    UNITY_TEST_ASSERT(       (condition), __LINE__, message)
#define TEST_ASSERT_TRUE_MESSAGE(condition, message)                                               UNITY_TEST_ASSERT(       (condition), __LINE__, message)
#define TEST_ASSERT_UNLESS_MESSAGE(condition, message)                                             UNITY_TEST_ASSERT(      !(condition), __LINE__, message)
#define TEST_ASSERT_FALSE_MESSAGE(condition, message)                                              UNITY_TEST_ASSERT(      !(condition), __LINE__, message)
#define TEST_ASSERT_NULL_MESSAGE(pointer, message)                                                 UNITY_TEST_ASSERT_NULL(    (pointer), __LINE__, message)
#define TEST_ASSERT_NOT_NULL_MESSAGE(pointer, message)                                             UNITY_TEST_ASSERT_NOT_NULL((pointer), __LINE__, message)

//Integers (of all sizes)
#define TEST_ASSERT_EQUAL_INT_MESSAGE(expected, actual, message)                                   UNITY_TEST_ASSERT_EQUAL_INT((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_INT8_MESSAGE(expected, actual, message)                                  UNITY_TEST_ASSERT_EQUAL_INT8((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_INT16_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_INT16((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_INT32_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_INT32((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_INT64_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_INT64((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_MESSAGE(expected, actual, message)                                       UNITY_TEST_ASSERT_EQUAL_INT((expected), (actual), __LINE__, message)
#define TEST_ASSERT_NOT_EQUAL_MESSAGE(expected, actual, message)                                   UNITY_TEST_ASSERT(((expected) !=  (actual)), __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT_MESSAGE(expected, actual, message)                                  UNITY_TEST_ASSERT_EQUAL_UINT( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT8_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_UINT8( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT16_MESSAGE(expected, actual, message)                                UNITY_TEST_ASSERT_EQUAL_UINT16( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT32_MESSAGE(expected, actual, message)                                UNITY_TEST_ASSERT_EQUAL_UINT32( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT64_MESSAGE(expected, actual, message)                                UNITY_TEST_ASSERT_EQUAL_UINT64( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX_MESSAGE(expected, actual, message)                                   UNITY_TEST_ASSERT_EQUAL_HEX32((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX8_MESSAGE(expected, actual, message)                                  UNITY_TEST_ASSERT_EQUAL_HEX8( (expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX16_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_HEX16((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX32_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_HEX32((expected), (actual), __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX64_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_HEX64((expected), (actual), __LINE__, message)
#define TEST_ASSERT_BITS_MESSAGE(mask, expected, actual, message)                                  UNITY_TEST_ASSERT_BITS((mask), (expected), (actual), __LINE__, message)
#define TEST_ASSERT_BITS_HIGH_MESSAGE(mask, actual, message)                                       UNITY_TEST_ASSERT_BITS((mask), (_UU32)(-1), (actual), __LINE__, message)
#define TEST_ASSERT_BITS_LOW_MESSAGE(mask, actual, message)                                        UNITY_TEST_ASSERT_BITS((mask), (_UU32)(0), (actual), __LINE__, message)
#define TEST_ASSERT_BIT_HIGH_MESSAGE(bit, actual, message)                                         UNITY_TEST_ASSERT_BITS(((_UU32)1 << bit), (_UU32)(-1), (actual), __LINE__, message)
#define TEST_ASSERT_BIT_LOW_MESSAGE(bit, actual, message)                                          UNITY_TEST_ASSERT_BITS(((_UU32)1 << bit), (_UU32)(0), (actual), __LINE__, message)

//Integer Ranges (of all sizes)
#define TEST_ASSERT_INT_WITHIN_MESSAGE(delta, expected, actual, message)                           UNITY_TEST_ASSERT_INT_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_INT8_WITHIN_MESSAGE(delta, expected, actual, message)                          UNITY_TEST_ASSERT_INT8_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_INT16_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_INT16_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_INT32_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_INT32_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_INT64_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_INT64_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_UINT_WITHIN_MESSAGE(delta, expected, actual, message)                          UNITY_TEST_ASSERT_UINT_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_UINT8_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_UINT8_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_UINT16_WITHIN_MESSAGE(delta, expected, actual, message)                        UNITY_TEST_ASSERT_UINT16_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_UINT32_WITHIN_MESSAGE(delta, expected, actual, message)                        UNITY_TEST_ASSERT_UINT32_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_UINT64_WITHIN_MESSAGE(delta, expected, actual, message)                        UNITY_TEST_ASSERT_UINT64_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_HEX_WITHIN_MESSAGE(delta, expected, actual, message)                           UNITY_TEST_ASSERT_HEX32_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_HEX8_WITHIN_MESSAGE(delta, expected, actual, message)                          UNITY_TEST_ASSERT_HEX8_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_HEX16_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_HEX16_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_HEX32_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_HEX32_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_HEX64_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_HEX64_WITHIN(delta, expected, actual, __LINE__, message)

//Structs and Strings
#define TEST_ASSERT_EQUAL_PTR_MESSAGE(expected, actual, message)                                   UNITY_TEST_ASSERT_EQUAL_PTR(expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_STRING_MESSAGE(expected, actual, message)                                UNITY_TEST_ASSERT_EQUAL_STRING(expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_STRING_LEN_MESSAGE(expected, actual, len, message)                       UNITY_TEST_ASSERT_EQUAL_STRING_LEN(expected, actual, len, __LINE__, message)
#define TEST_ASSERT_EQUAL_MEMORY_MESSAGE(expected, actual, len, message)                           UNITY_TEST_ASSERT_EQUAL_MEMORY(expected, actual, len, __LINE__, message)

//Arrays
#define TEST_ASSERT_EQUAL_INT_ARRAY_MESSAGE(expected, actual, num_elements, message)               UNITY_TEST_ASSERT_EQUAL_INT_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_INT8_ARRAY_MESSAGE(expected, actual, num_elements, message)              UNITY_TEST_ASSERT_EQUAL_INT8_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_INT16_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_INT16_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_INT32_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_INT32_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_INT64_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_INT64_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT_ARRAY_MESSAGE(expected, actual, num_elements, message)              UNITY_TEST_ASSERT_EQUAL_UINT_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT8_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_UINT8_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT16_ARRAY_MESSAGE(expected, actual, num_elements, message)            UNITY_TEST_ASSERT_EQUAL_UINT16_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT32_ARRAY_MESSAGE(expected, actual, num_elements, message)            UNITY_TEST_ASSERT_EQUAL_UINT32_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_UINT64_ARRAY_MESSAGE(expected, actual, num_elements, message)            UNITY_TEST_ASSERT_EQUAL_UINT64_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX_ARRAY_MESSAGE(expected, actual, num_elements, message)               UNITY_TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX8_ARRAY_MESSAGE(expected, actual, num_elements, message)              UNITY_TEST_ASSERT_EQUAL_HEX8_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX16_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_HEX16_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX32_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_HEX64_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_HEX64_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_PTR_ARRAY_MESSAGE(expected, actual, num_elements, message)               UNITY_TEST_ASSERT_EQUAL_PTR_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_STRING_ARRAY_MESSAGE(expected, actual, num_elements, message)            UNITY_TEST_ASSERT_EQUAL_STRING_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_EQUAL_MEMORY_ARRAY_MESSAGE(expected, actual, len, num_elements, message)       UNITY_TEST_ASSERT_EQUAL_MEMORY_ARRAY(expected, actual, len, num_elements, __LINE__, message)

//Floating Point (If Enabled)
#define TEST_ASSERT_FLOAT_WITHIN_MESSAGE(delta, expected, actual, message)                         UNITY_TEST_ASSERT_FLOAT_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_FLOAT_MESSAGE(expected, actual, message)                                 UNITY_TEST_ASSERT_EQUAL_FLOAT(expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_FLOAT_ARRAY_MESSAGE(expected, actual, num_elements, message)             UNITY_TEST_ASSERT_EQUAL_FLOAT_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_INF_MESSAGE(actual, message)                                          UNITY_TEST_ASSERT_FLOAT_IS_INF(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NEG_INF_MESSAGE(actual, message)                                      UNITY_TEST_ASSERT_FLOAT_IS_NEG_INF(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NAN_MESSAGE(actual, message)                                          UNITY_TEST_ASSERT_FLOAT_IS_NAN(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_DETERMINATE_MESSAGE(actual, message)                                  UNITY_TEST_ASSERT_FLOAT_IS_DETERMINATE(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NOT_INF_MESSAGE(actual, message)                                      UNITY_TEST_ASSERT_FLOAT_IS_NOT_INF(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NOT_NEG_INF_MESSAGE(actual, message)                                  UNITY_TEST_ASSERT_FLOAT_IS_NOT_NEG_INF(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NOT_NAN_MESSAGE(actual, message)                                      UNITY_TEST_ASSERT_FLOAT_IS_NOT_NAN(actual, __LINE__, message)
#define TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE_MESSAGE(actual, message)                              UNITY_TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE(actual, __LINE__, message)

//Double (If Enabled)
#define TEST_ASSERT_DOUBLE_WITHIN_MESSAGE(delta, expected, actual, message)                        UNITY_TEST_ASSERT_DOUBLE_WITHIN(delta, expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_DOUBLE_MESSAGE(expected, actual, message)                                UNITY_TEST_ASSERT_EQUAL_DOUBLE(expected, actual, __LINE__, message)
#define TEST_ASSERT_EQUAL_DOUBLE_ARRAY_MESSAGE(expected, actual, num_elements, message)            UNITY_TEST_ASSERT_EQUAL_DOUBLE_ARRAY(expected, actual, num_elements, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_INF_MESSAGE(actual, message)                                         UNITY_TEST_ASSERT_DOUBLE_IS_INF(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NEG_INF_MESSAGE(actual, message)                                     UNITY_TEST_ASSERT_DOUBLE_IS_NEG_INF(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NAN_MESSAGE(actual, message)                                         UNITY_TEST_ASSERT_DOUBLE_IS_NAN(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_DETERMINATE_MESSAGE(actual, message)                                 UNITY_TEST_ASSERT_DOUBLE_IS_DETERMINATE(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NOT_INF_MESSAGE(actual, message)                                     UNITY_TEST_ASSERT_DOUBLE_IS_NOT_INF(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF_MESSAGE(actual, message)                                 UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NOT_NAN_MESSAGE(actual, message)                                     UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NAN(actual, __LINE__, message)
#define TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE_MESSAGE(actual, message)                             UNITY_TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE(actual, __LINE__, message)

//end of UNITY_FRAMEWORK_H
#endif

test/vendor/unity_internals.h

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
/* ==========================================
    Unity Project - A Test Framework for C
    Copyright (c) 2007-14 Mike Karlesky, Mark VanderVoord, Greg Williams
    [Released under MIT License. Please refer to license.txt for details]
========================================== */

#ifndef UNITY_INTERNALS_H
#define UNITY_INTERNALS_H

#ifdef UNITY_INCLUDE_CONFIG_H
#include "unity_config.h"
#endif

#include <setjmp.h>

// Unity Attempts to Auto-Detect Integer Types
// Attempt 1: UINT_MAX, ULONG_MAX, etc in <stdint.h>
// Attempt 2: UINT_MAX, ULONG_MAX, etc in <limits.h>
// Attempt 3: Deduced from sizeof() macros
#ifndef UNITY_EXCLUDE_STDINT_H
#include <stdint.h>
#endif

#ifndef UNITY_EXCLUDE_LIMITS_H
#include <limits.h>
#endif

#ifndef UNITY_EXCLUDE_SIZEOF
#ifndef UINT_MAX
#define UINT_MAX     (sizeof(unsigned int) * 256 - 1)
#endif
#ifndef ULONG_MAX
#define ULONG_MAX    (sizeof(unsigned long) * 256 - 1)
#endif
#ifndef UINTPTR_MAX
//apparently this is not a constant expression: (sizeof(unsigned int *) * 256 - 1) so we have to just let this fall through
#endif
#endif
//-------------------------------------------------------
// Guess Widths If Not Specified
//-------------------------------------------------------

// Determine the size of an int, if not already specificied.
// We cannot use sizeof(int), because it is not yet defined
// at this stage in the trnslation of the C program.
// Therefore, infer it from UINT_MAX if possible.
#ifndef UNITY_INT_WIDTH
  #ifdef UINT_MAX
    #if (UINT_MAX == 0xFFFF)
      #define UNITY_INT_WIDTH (16)
    #elif (UINT_MAX == 0xFFFFFFFF)
      #define UNITY_INT_WIDTH (32)
    #elif (UINT_MAX == 0xFFFFFFFFFFFFFFFF)
      #define UNITY_INT_WIDTH (64)
    #endif
  #endif
#endif
#ifndef UNITY_INT_WIDTH
  #define UNITY_INT_WIDTH (32)
#endif

// Determine the size of a long, if not already specified,
// by following the process used above to define
// UNITY_INT_WIDTH.
#ifndef UNITY_LONG_WIDTH
  #ifdef ULONG_MAX
    #if (ULONG_MAX == 0xFFFF)
      #define UNITY_LONG_WIDTH (16)
    #elif (ULONG_MAX == 0xFFFFFFFF)
      #define UNITY_LONG_WIDTH (32)
    #elif (ULONG_MAX == 0xFFFFFFFFFFFFFFFF)
      #define UNITY_LONG_WIDTH (64)
    #endif
  #endif
#endif
#ifndef UNITY_LONG_WIDTH
  #define UNITY_LONG_WIDTH (32)
#endif

// Determine the size of a pointer, if not already specified,
// by following the process used above to define
// UNITY_INT_WIDTH.
#ifndef UNITY_POINTER_WIDTH
  #ifdef UINTPTR_MAX
    #if (UINTPTR_MAX+0 <= 0xFFFF)
      #define UNITY_POINTER_WIDTH (16)
    #elif (UINTPTR_MAX+0 <= 0xFFFFFFFF)
      #define UNITY_POINTER_WIDTH (32)
    #elif (UINTPTR_MAX+0 <= 0xFFFFFFFFFFFFFFFF)
      #define UNITY_POINTER_WIDTH (64)
    #endif
  #endif
#endif
#ifndef UNITY_POINTER_WIDTH
  #ifdef INTPTR_MAX
    #if (INTPTR_MAX+0 <= 0x7FFF)
      #define UNITY_POINTER_WIDTH (16)
    #elif (INTPTR_MAX+0 <= 0x7FFFFFFF)
      #define UNITY_POINTER_WIDTH (32)
    #elif (INTPTR_MAX+0 <= 0x7FFFFFFFFFFFFFFF)
      #define UNITY_POINTER_WIDTH (64)
    #endif
  #endif
#endif
#ifndef UNITY_POINTER_WIDTH
  #define UNITY_POINTER_WIDTH UNITY_LONG_WIDTH
#endif

//-------------------------------------------------------
// Int Support (Define types based on detected sizes)
//-------------------------------------------------------

#if (UNITY_INT_WIDTH == 32)
    typedef unsigned char   _UU8;
    typedef unsigned short  _UU16;
    typedef unsigned int    _UU32;
    typedef signed char     _US8;
    typedef signed short    _US16;
    typedef signed int      _US32;
#elif (UNITY_INT_WIDTH == 16)
    typedef unsigned char   _UU8;
    typedef unsigned int    _UU16;
    typedef unsigned long   _UU32;
    typedef signed char     _US8;
    typedef signed int      _US16;
    typedef signed long     _US32;
#else
    #error Invalid UNITY_INT_WIDTH specified! (16 or 32 are supported)
#endif

//-------------------------------------------------------
// 64-bit Support
//-------------------------------------------------------

#ifndef UNITY_SUPPORT_64
#if UNITY_LONG_WIDTH > 32
#define UNITY_SUPPORT_64
#endif
#endif
#ifndef UNITY_SUPPORT_64
#if UNITY_POINTER_WIDTH > 32
#define UNITY_SUPPORT_64
#endif
#endif

#ifndef UNITY_SUPPORT_64

//No 64-bit Support
typedef _UU32 _U_UINT;
typedef _US32 _U_SINT;

#else

//64-bit Support
#if (UNITY_LONG_WIDTH == 32)
    typedef unsigned long long _UU64;
    typedef signed long long   _US64;
#elif (UNITY_LONG_WIDTH == 64)
    typedef unsigned long      _UU64;
    typedef signed long        _US64;
#else
    #error Invalid UNITY_LONG_WIDTH specified! (32 or 64 are supported)
#endif
typedef _UU64 _U_UINT;
typedef _US64 _U_SINT;

#endif

//-------------------------------------------------------
// Pointer Support
//-------------------------------------------------------

#if (UNITY_POINTER_WIDTH == 32)
    typedef _UU32 _UP;
#define UNITY_DISPLAY_STYLE_POINTER UNITY_DISPLAY_STYLE_HEX32
#elif (UNITY_POINTER_WIDTH == 64)
    typedef _UU64 _UP;
#define UNITY_DISPLAY_STYLE_POINTER UNITY_DISPLAY_STYLE_HEX64
#elif (UNITY_POINTER_WIDTH == 16)
    typedef _UU16 _UP;
#define UNITY_DISPLAY_STYLE_POINTER UNITY_DISPLAY_STYLE_HEX16
#else
    #error Invalid UNITY_POINTER_WIDTH specified! (16, 32 or 64 are supported)
#endif

#ifndef UNITY_PTR_ATTRIBUTE
  #define UNITY_PTR_ATTRIBUTE
#endif

//-------------------------------------------------------
// Float Support
//-------------------------------------------------------

#ifdef UNITY_EXCLUDE_FLOAT

//No Floating Point Support
#undef UNITY_INCLUDE_FLOAT
#undef UNITY_FLOAT_PRECISION
#undef UNITY_FLOAT_TYPE
#undef UNITY_FLOAT_VERBOSE

#else

#ifndef UNITY_INCLUDE_FLOAT
#define UNITY_INCLUDE_FLOAT
#endif

//Floating Point Support
#ifndef UNITY_FLOAT_PRECISION
#define UNITY_FLOAT_PRECISION (0.00001f)
#endif
#ifndef UNITY_FLOAT_TYPE
#define UNITY_FLOAT_TYPE float
#endif
typedef UNITY_FLOAT_TYPE _UF;

#endif

//-------------------------------------------------------
// Double Float Support
//-------------------------------------------------------

//unlike FLOAT, we DON'T include by default
#ifndef UNITY_EXCLUDE_DOUBLE
#ifndef UNITY_INCLUDE_DOUBLE
#define UNITY_EXCLUDE_DOUBLE
#endif
#endif

#ifdef UNITY_EXCLUDE_DOUBLE

//No Floating Point Support
#undef UNITY_DOUBLE_PRECISION
#undef UNITY_DOUBLE_TYPE
#undef UNITY_DOUBLE_VERBOSE

#ifdef UNITY_INCLUDE_DOUBLE
#undef UNITY_INCLUDE_DOUBLE
#endif

#else

//Double Floating Point Support
#ifndef UNITY_DOUBLE_PRECISION
#define UNITY_DOUBLE_PRECISION (1e-12f)
#endif
#ifndef UNITY_DOUBLE_TYPE
#define UNITY_DOUBLE_TYPE double
#endif
typedef UNITY_DOUBLE_TYPE _UD;

#endif

#ifdef UNITY_DOUBLE_VERBOSE
#ifndef UNITY_FLOAT_VERBOSE
#define UNITY_FLOAT_VERBOSE
#endif
#endif

//-------------------------------------------------------
// Output Method: stdout (DEFAULT)
//-------------------------------------------------------
#ifndef UNITY_OUTPUT_CHAR
//Default to using putchar, which is defined in stdio.h
#include <stdio.h>
#define UNITY_OUTPUT_CHAR(a) putchar(a)
#else
//If defined as something else, make sure we declare it here so it's ready for use
extern int UNITY_OUTPUT_CHAR(int);
#endif

#ifndef UNITY_OUTPUT_START
#define UNITY_OUTPUT_START()
#endif

#ifndef UNITY_OUTPUT_COMPLETE
#define UNITY_OUTPUT_COMPLETE()
#endif

//-------------------------------------------------------
// Footprint
//-------------------------------------------------------

#ifndef UNITY_LINE_TYPE
#define UNITY_LINE_TYPE _U_UINT
#endif

#ifndef UNITY_COUNTER_TYPE
#define UNITY_COUNTER_TYPE _U_UINT
#endif

//-------------------------------------------------------
// Language Features Available
//-------------------------------------------------------
#if !defined(UNITY_WEAK_ATTRIBUTE) && !defined(UNITY_WEAK_PRAGMA)
#   ifdef __GNUC__ // includes clang
#       if !(defined(__WIN32__) && defined(__clang__))
#           define UNITY_WEAK_ATTRIBUTE __attribute__((weak))
#       endif
#   endif
#endif

#ifdef UNITY_NO_WEAK
#   undef UNITY_WEAK_ATTRIBUTE
#   undef UNITY_WEAK_PRAGMA
#endif


//-------------------------------------------------------
// Internal Structs Needed
//-------------------------------------------------------

typedef void (*UnityTestFunction)(void);

#define UNITY_DISPLAY_RANGE_INT  (0x10)
#define UNITY_DISPLAY_RANGE_UINT (0x20)
#define UNITY_DISPLAY_RANGE_HEX  (0x40)
#define UNITY_DISPLAY_RANGE_AUTO (0x80)

typedef enum
{
#if (UNITY_INT_WIDTH == 16)
    UNITY_DISPLAY_STYLE_INT      = 2 + UNITY_DISPLAY_RANGE_INT + UNITY_DISPLAY_RANGE_AUTO,
#elif (UNITY_INT_WIDTH  == 32)
    UNITY_DISPLAY_STYLE_INT      = 4 + UNITY_DISPLAY_RANGE_INT + UNITY_DISPLAY_RANGE_AUTO,
#elif (UNITY_INT_WIDTH  == 64)
    UNITY_DISPLAY_STYLE_INT      = 8 + UNITY_DISPLAY_RANGE_INT + UNITY_DISPLAY_RANGE_AUTO,
#endif
    UNITY_DISPLAY_STYLE_INT8     = 1 + UNITY_DISPLAY_RANGE_INT,
    UNITY_DISPLAY_STYLE_INT16    = 2 + UNITY_DISPLAY_RANGE_INT,
    UNITY_DISPLAY_STYLE_INT32    = 4 + UNITY_DISPLAY_RANGE_INT,
#ifdef UNITY_SUPPORT_64
    UNITY_DISPLAY_STYLE_INT64    = 8 + UNITY_DISPLAY_RANGE_INT,
#endif

#if (UNITY_INT_WIDTH == 16)
    UNITY_DISPLAY_STYLE_UINT     = 2 + UNITY_DISPLAY_RANGE_UINT + UNITY_DISPLAY_RANGE_AUTO,
#elif (UNITY_INT_WIDTH  == 32)
    UNITY_DISPLAY_STYLE_UINT     = 4 + UNITY_DISPLAY_RANGE_UINT + UNITY_DISPLAY_RANGE_AUTO,
#elif (UNITY_INT_WIDTH  == 64)
    UNITY_DISPLAY_STYLE_UINT     = 8 + UNITY_DISPLAY_RANGE_UINT + UNITY_DISPLAY_RANGE_AUTO,
#endif
    UNITY_DISPLAY_STYLE_UINT8    = 1 + UNITY_DISPLAY_RANGE_UINT,
    UNITY_DISPLAY_STYLE_UINT16   = 2 + UNITY_DISPLAY_RANGE_UINT,
    UNITY_DISPLAY_STYLE_UINT32   = 4 + UNITY_DISPLAY_RANGE_UINT,
#ifdef UNITY_SUPPORT_64
    UNITY_DISPLAY_STYLE_UINT64   = 8 + UNITY_DISPLAY_RANGE_UINT,
#endif
    UNITY_DISPLAY_STYLE_HEX8     = 1 + UNITY_DISPLAY_RANGE_HEX,
    UNITY_DISPLAY_STYLE_HEX16    = 2 + UNITY_DISPLAY_RANGE_HEX,
    UNITY_DISPLAY_STYLE_HEX32    = 4 + UNITY_DISPLAY_RANGE_HEX,
#ifdef UNITY_SUPPORT_64
    UNITY_DISPLAY_STYLE_HEX64    = 8 + UNITY_DISPLAY_RANGE_HEX,
#endif
    UNITY_DISPLAY_STYLE_UNKNOWN
} UNITY_DISPLAY_STYLE_T;

#ifndef UNITY_EXCLUDE_FLOAT
typedef enum _UNITY_FLOAT_TRAIT_T
{
    UNITY_FLOAT_IS_NOT_INF       = 0,
    UNITY_FLOAT_IS_INF,
    UNITY_FLOAT_IS_NOT_NEG_INF,
    UNITY_FLOAT_IS_NEG_INF,
    UNITY_FLOAT_IS_NOT_NAN,
    UNITY_FLOAT_IS_NAN,
    UNITY_FLOAT_IS_NOT_DET,
    UNITY_FLOAT_IS_DET,
} UNITY_FLOAT_TRAIT_T;
#endif

struct _Unity
{
    const char* TestFile;
    const char* CurrentTestName;
    UNITY_LINE_TYPE CurrentTestLineNumber;
    UNITY_COUNTER_TYPE NumberOfTests;
    UNITY_COUNTER_TYPE TestFailures;
    UNITY_COUNTER_TYPE TestIgnores;
    UNITY_COUNTER_TYPE CurrentTestFailed;
    UNITY_COUNTER_TYPE CurrentTestIgnored;
    jmp_buf AbortFrame;
};

extern struct _Unity Unity;

//-------------------------------------------------------
// Test Suite Management
//-------------------------------------------------------

void UnityBegin(const char* filename);
int  UnityEnd(void);
void UnityConcludeTest(void);
void UnityDefaultTestRun(UnityTestFunction Func, const char* FuncName, const int FuncLineNum);

//-------------------------------------------------------
// Test Output
//-------------------------------------------------------

void UnityPrint(const char* string);
void UnityPrintMask(const _U_UINT mask, const _U_UINT number);
void UnityPrintNumberByStyle(const _U_SINT number, const UNITY_DISPLAY_STYLE_T style);
void UnityPrintNumber(const _U_SINT number);
void UnityPrintNumberUnsigned(const _U_UINT number);
void UnityPrintNumberHex(const _U_UINT number, const char nibbles);

#ifdef UNITY_FLOAT_VERBOSE
void UnityPrintFloat(const _UF number);
#endif

//-------------------------------------------------------
// Test Assertion Fuctions
//-------------------------------------------------------
//  Use the macros below this section instead of calling
//  these directly. The macros have a consistent naming
//  convention and will pull in file and line information
//  for you.

void UnityAssertEqualNumber(const _U_SINT expected,
                            const _U_SINT actual,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber,
                            const UNITY_DISPLAY_STYLE_T style);

void UnityAssertEqualIntArray(UNITY_PTR_ATTRIBUTE const void* expected,
                              UNITY_PTR_ATTRIBUTE const void* actual,
                              const _UU32 num_elements,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber,
                              const UNITY_DISPLAY_STYLE_T style);

void UnityAssertBits(const _U_SINT mask,
                     const _U_SINT expected,
                     const _U_SINT actual,
                     const char* msg,
                     const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualString(const char* expected,
                            const char* actual,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualStringLen(const char* expected,
                            const char* actual,
                            const _UU32 length,
                            const char* msg,
                            const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualStringArray( const char** expected,
                                  const char** actual,
                                  const _UU32 num_elements,
                                  const char* msg,
                                  const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualMemory( UNITY_PTR_ATTRIBUTE const void* expected,
                             UNITY_PTR_ATTRIBUTE const void* actual,
                             const _UU32 length,
                             const _UU32 num_elements,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber);

void UnityAssertNumbersWithin(const _U_SINT delta,
                              const _U_SINT expected,
                              const _U_SINT actual,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber,
                              const UNITY_DISPLAY_STYLE_T style);

void UnityFail(const char* message, const UNITY_LINE_TYPE line);

void UnityIgnore(const char* message, const UNITY_LINE_TYPE line);

#ifndef UNITY_EXCLUDE_FLOAT
void UnityAssertFloatsWithin(const _UF delta,
                             const _UF expected,
                             const _UF actual,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualFloatArray(UNITY_PTR_ATTRIBUTE const _UF* expected,
                                UNITY_PTR_ATTRIBUTE const _UF* actual,
                                const _UU32 num_elements,
                                const char* msg,
                                const UNITY_LINE_TYPE lineNumber);

void UnityAssertFloatSpecial(const _UF actual,
                             const char* msg,
                             const UNITY_LINE_TYPE lineNumber,
                             const UNITY_FLOAT_TRAIT_T style);
#endif

#ifndef UNITY_EXCLUDE_DOUBLE
void UnityAssertDoublesWithin(const _UD delta,
                              const _UD expected,
                              const _UD actual,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber);

void UnityAssertEqualDoubleArray(UNITY_PTR_ATTRIBUTE const _UD* expected,
                                 UNITY_PTR_ATTRIBUTE const _UD* actual,
                                 const _UU32 num_elements,
                                 const char* msg,
                                 const UNITY_LINE_TYPE lineNumber);

void UnityAssertDoubleSpecial(const _UD actual,
                              const char* msg,
                              const UNITY_LINE_TYPE lineNumber,
                              const UNITY_FLOAT_TRAIT_T style);
#endif

//-------------------------------------------------------
// Error Strings We Might Need
//-------------------------------------------------------

extern const char UnityStrErrFloat[];
extern const char UnityStrErrDouble[];
extern const char UnityStrErr64[];

//-------------------------------------------------------
// Test Running Macros
//-------------------------------------------------------

#define TEST_PROTECT() (setjmp(Unity.AbortFrame) == 0)

#define TEST_ABORT() {longjmp(Unity.AbortFrame, 1);}

//This tricky series of macros gives us an optional line argument to treat it as RUN_TEST(func, num=__LINE__)
#ifndef RUN_TEST
#ifdef __STDC_VERSION__
#if __STDC_VERSION__ >= 199901L
#define RUN_TEST(...) UnityDefaultTestRun(RUN_TEST_FIRST(__VA_ARGS__), RUN_TEST_SECOND(__VA_ARGS__))
#define RUN_TEST_FIRST(...) RUN_TEST_FIRST_HELPER(__VA_ARGS__, throwaway)
#define RUN_TEST_FIRST_HELPER(first,...) first, #first
#define RUN_TEST_SECOND(...) RUN_TEST_SECOND_HELPER(__VA_ARGS__, __LINE__, throwaway)
#define RUN_TEST_SECOND_HELPER(first,second,...) second
#endif
#endif
#endif

//If we can't do the tricky version, we'll just have to require them to always include the line number
#ifndef RUN_TEST
#ifdef CMOCK
#define RUN_TEST(func, num) UnityDefaultTestRun(func, #func, num)
#else
#define RUN_TEST(func) UnityDefaultTestRun(func, #func, __LINE__)
#endif
#endif

#define TEST_LINE_NUM (Unity.CurrentTestLineNumber)
#define TEST_IS_IGNORED (Unity.CurrentTestIgnored)
#define UNITY_NEW_TEST(a) \
    Unity.CurrentTestName = a; \
    Unity.CurrentTestLineNumber = (UNITY_LINE_TYPE)(__LINE__); \
    Unity.NumberOfTests++;

#ifndef UNITY_BEGIN
#define UNITY_BEGIN() UnityBegin(__FILE__)
#endif

#ifndef UNITY_END
#define UNITY_END() UnityEnd()
#endif

#define UNITY_UNUSED(x) (void)(sizeof(x))

//-------------------------------------------------------
// Basic Fail and Ignore
//-------------------------------------------------------

#define UNITY_TEST_FAIL(line, message)   UnityFail(   (message), (UNITY_LINE_TYPE)line);
#define UNITY_TEST_IGNORE(line, message) UnityIgnore( (message), (UNITY_LINE_TYPE)line);

//-------------------------------------------------------
// Test Asserts
//-------------------------------------------------------

#define UNITY_TEST_ASSERT(condition, line, message)                                              if (condition) {} else {UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, message);}
#define UNITY_TEST_ASSERT_NULL(pointer, line, message)                                           UNITY_TEST_ASSERT(((pointer) == NULL),  (UNITY_LINE_TYPE)line, message)
#define UNITY_TEST_ASSERT_NOT_NULL(pointer, line, message)                                       UNITY_TEST_ASSERT(((pointer) != NULL),  (UNITY_LINE_TYPE)line, message)

#define UNITY_TEST_ASSERT_EQUAL_INT(expected, actual, line, message)                             UnityAssertEqualNumber((_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT)
#define UNITY_TEST_ASSERT_EQUAL_INT8(expected, actual, line, message)                            UnityAssertEqualNumber((_U_SINT)(_US8 )(expected), (_U_SINT)(_US8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT8)
#define UNITY_TEST_ASSERT_EQUAL_INT16(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(_US16)(expected), (_U_SINT)(_US16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT16)
#define UNITY_TEST_ASSERT_EQUAL_INT32(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(_US32)(expected), (_U_SINT)(_US32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT32)
#define UNITY_TEST_ASSERT_EQUAL_UINT(expected, actual, line, message)                            UnityAssertEqualNumber((_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT)
#define UNITY_TEST_ASSERT_EQUAL_UINT8(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(_UU8 )(expected), (_U_SINT)(_UU8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT8)
#define UNITY_TEST_ASSERT_EQUAL_UINT16(expected, actual, line, message)                          UnityAssertEqualNumber((_U_SINT)(_UU16)(expected), (_U_SINT)(_UU16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT16)
#define UNITY_TEST_ASSERT_EQUAL_UINT32(expected, actual, line, message)                          UnityAssertEqualNumber((_U_SINT)(_UU32)(expected), (_U_SINT)(_UU32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT32)
#define UNITY_TEST_ASSERT_EQUAL_HEX8(expected, actual, line, message)                            UnityAssertEqualNumber((_U_SINT)(_US8 )(expected), (_U_SINT)(_US8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX8)
#define UNITY_TEST_ASSERT_EQUAL_HEX16(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(_US16)(expected), (_U_SINT)(_US16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX16)
#define UNITY_TEST_ASSERT_EQUAL_HEX32(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(_US32)(expected), (_U_SINT)(_US32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX32)
#define UNITY_TEST_ASSERT_BITS(mask, expected, actual, line, message)                            UnityAssertBits((_U_SINT)(mask), (_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line)

#define UNITY_TEST_ASSERT_INT_WITHIN(delta, expected, actual, line, message)                     UnityAssertNumbersWithin((_U_SINT)(delta), (_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT)
#define UNITY_TEST_ASSERT_INT8_WITHIN(delta, expected, actual, line, message)                    UnityAssertNumbersWithin((_U_SINT)(_US8 )(delta), (_U_SINT)(_US8 )(expected), (_U_SINT)(_US8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT8)
#define UNITY_TEST_ASSERT_INT16_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(_US16)(delta), (_U_SINT)(_US16)(expected), (_U_SINT)(_US16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT16)
#define UNITY_TEST_ASSERT_INT32_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(_US32)(delta), (_U_SINT)(_US32)(expected), (_U_SINT)(_US32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT32)
#define UNITY_TEST_ASSERT_UINT_WITHIN(delta, expected, actual, line, message)                    UnityAssertNumbersWithin((_U_SINT)(delta), (_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT)
#define UNITY_TEST_ASSERT_UINT8_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU8 )(delta), (_U_SINT)(_U_UINT)(_UU8 )(expected), (_U_SINT)(_U_UINT)(_UU8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT8)
#define UNITY_TEST_ASSERT_UINT16_WITHIN(delta, expected, actual, line, message)                  UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU16)(delta), (_U_SINT)(_U_UINT)(_UU16)(expected), (_U_SINT)(_U_UINT)(_UU16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT16)
#define UNITY_TEST_ASSERT_UINT32_WITHIN(delta, expected, actual, line, message)                  UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU32)(delta), (_U_SINT)(_U_UINT)(_UU32)(expected), (_U_SINT)(_U_UINT)(_UU32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT32)
#define UNITY_TEST_ASSERT_HEX8_WITHIN(delta, expected, actual, line, message)                    UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU8 )(delta), (_U_SINT)(_U_UINT)(_UU8 )(expected), (_U_SINT)(_U_UINT)(_UU8 )(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX8)
#define UNITY_TEST_ASSERT_HEX16_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU16)(delta), (_U_SINT)(_U_UINT)(_UU16)(expected), (_U_SINT)(_U_UINT)(_UU16)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX16)
#define UNITY_TEST_ASSERT_HEX32_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(_U_UINT)(_UU32)(delta), (_U_SINT)(_U_UINT)(_UU32)(expected), (_U_SINT)(_U_UINT)(_UU32)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX32)

#define UNITY_TEST_ASSERT_EQUAL_PTR(expected, actual, line, message)                             UnityAssertEqualNumber((_U_SINT)(_UP)(expected), (_U_SINT)(_UP)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_POINTER)
#define UNITY_TEST_ASSERT_EQUAL_STRING(expected, actual, line, message)                          UnityAssertEqualString((const char*)(expected), (const char*)(actual), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_EQUAL_STRING_LEN(expected, actual, len, line, message)                 UnityAssertEqualStringLen((const char*)(expected), (const char*)(actual), (_UU32)(len), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_EQUAL_MEMORY(expected, actual, len, line, message)                     UnityAssertEqualMemory((UNITY_PTR_ATTRIBUTE void*)(expected), (UNITY_PTR_ATTRIBUTE void*)(actual), (_UU32)(len), 1, (message), (UNITY_LINE_TYPE)line)

#define UNITY_TEST_ASSERT_EQUAL_INT_ARRAY(expected, actual, num_elements, line, message)         UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT)
#define UNITY_TEST_ASSERT_EQUAL_INT8_ARRAY(expected, actual, num_elements, line, message)        UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT8)
#define UNITY_TEST_ASSERT_EQUAL_INT16_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT16)
#define UNITY_TEST_ASSERT_EQUAL_INT32_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT32)
#define UNITY_TEST_ASSERT_EQUAL_UINT_ARRAY(expected, actual, num_elements, line, message)        UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT)
#define UNITY_TEST_ASSERT_EQUAL_UINT8_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT8)
#define UNITY_TEST_ASSERT_EQUAL_UINT16_ARRAY(expected, actual, num_elements, line, message)      UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT16)
#define UNITY_TEST_ASSERT_EQUAL_UINT32_ARRAY(expected, actual, num_elements, line, message)      UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT32)
#define UNITY_TEST_ASSERT_EQUAL_HEX8_ARRAY(expected, actual, num_elements, line, message)        UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX8)
#define UNITY_TEST_ASSERT_EQUAL_HEX16_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX16)
#define UNITY_TEST_ASSERT_EQUAL_HEX32_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(expected), (UNITY_PTR_ATTRIBUTE const void*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX32)
#define UNITY_TEST_ASSERT_EQUAL_PTR_ARRAY(expected, actual, num_elements, line, message)         UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const void*)(_UP*)(expected), (const void*)(_UP*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_POINTER)
#define UNITY_TEST_ASSERT_EQUAL_STRING_ARRAY(expected, actual, num_elements, line, message)      UnityAssertEqualStringArray((const char**)(expected), (const char**)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_EQUAL_MEMORY_ARRAY(expected, actual, len, num_elements, line, message) UnityAssertEqualMemory((UNITY_PTR_ATTRIBUTE void*)(expected), (UNITY_PTR_ATTRIBUTE void*)(actual), (_UU32)(len), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line)

#ifdef UNITY_SUPPORT_64
#define UNITY_TEST_ASSERT_EQUAL_INT64(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT64)
#define UNITY_TEST_ASSERT_EQUAL_UINT64(expected, actual, line, message)                          UnityAssertEqualNumber((_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT64)
#define UNITY_TEST_ASSERT_EQUAL_HEX64(expected, actual, line, message)                           UnityAssertEqualNumber((_U_SINT)(expected), (_U_SINT)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX64)
#define UNITY_TEST_ASSERT_EQUAL_INT64_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const _U_SINT*)(expected), (UNITY_PTR_ATTRIBUTE const _U_SINT*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT64)
#define UNITY_TEST_ASSERT_EQUAL_UINT64_ARRAY(expected, actual, num_elements, line, message)      UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const _U_SINT*)(expected), (UNITY_PTR_ATTRIBUTE const _U_SINT*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT64)
#define UNITY_TEST_ASSERT_EQUAL_HEX64_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualIntArray((UNITY_PTR_ATTRIBUTE const _U_SINT*)(expected), (UNITY_PTR_ATTRIBUTE const _U_SINT*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX64)
#define UNITY_TEST_ASSERT_INT64_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(delta), (_U_SINT)(expected), (_U_SINT)(actual), NULL, (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_INT64)
#define UNITY_TEST_ASSERT_UINT64_WITHIN(delta, expected, actual, line, message)                  UnityAssertNumbersWithin((_U_SINT)(delta), (_U_SINT)(expected), (_U_SINT)(actual), NULL, (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_UINT64)
#define UNITY_TEST_ASSERT_HEX64_WITHIN(delta, expected, actual, line, message)                   UnityAssertNumbersWithin((_U_SINT)(delta), (_U_SINT)(expected), (_U_SINT)(actual), NULL, (UNITY_LINE_TYPE)line, UNITY_DISPLAY_STYLE_HEX64)
#else
#define UNITY_TEST_ASSERT_EQUAL_INT64(expected, actual, line, message)                           UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_EQUAL_UINT64(expected, actual, line, message)                          UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_EQUAL_HEX64(expected, actual, line, message)                           UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_EQUAL_INT64_ARRAY(expected, actual, num_elements, line, message)       UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_EQUAL_UINT64_ARRAY(expected, actual, num_elements, line, message)      UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_EQUAL_HEX64_ARRAY(expected, actual, num_elements, line, message)       UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_INT64_WITHIN(delta, expected, actual, line, message)                   UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_UINT64_WITHIN(delta, expected, actual, line, message)                  UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#define UNITY_TEST_ASSERT_HEX64_WITHIN(delta, expected, actual, line, message)                   UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErr64)
#endif

#ifdef UNITY_EXCLUDE_FLOAT
#define UNITY_TEST_ASSERT_FLOAT_WITHIN(delta, expected, actual, line, message)                   UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_EQUAL_FLOAT(expected, actual, line, message)                           UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_EQUAL_FLOAT_ARRAY(expected, actual, num_elements, line, message)       UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_INF(actual, line, message)                                    UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NEG_INF(actual, line, message)                                UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NAN(actual, line, message)                                    UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_DETERMINATE(actual, line, message)                            UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_INF(actual, line, message)                                UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_NEG_INF(actual, line, message)                            UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_NAN(actual, line, message)                                UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE(actual, line, message)                        UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrFloat)
#else
#define UNITY_TEST_ASSERT_FLOAT_WITHIN(delta, expected, actual, line, message)                   UnityAssertFloatsWithin((_UF)(delta), (_UF)(expected), (_UF)(actual), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_EQUAL_FLOAT(expected, actual, line, message)                           UNITY_TEST_ASSERT_FLOAT_WITHIN((_UF)(expected) * (_UF)UNITY_FLOAT_PRECISION, (_UF)expected, (_UF)actual, (UNITY_LINE_TYPE)line, message)
#define UNITY_TEST_ASSERT_EQUAL_FLOAT_ARRAY(expected, actual, num_elements, line, message)       UnityAssertEqualFloatArray((_UF*)(expected), (_UF*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_FLOAT_IS_INF(actual, line, message)                                    UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_INF)
#define UNITY_TEST_ASSERT_FLOAT_IS_NEG_INF(actual, line, message)                                UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NEG_INF)
#define UNITY_TEST_ASSERT_FLOAT_IS_NAN(actual, line, message)                                    UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NAN)
#define UNITY_TEST_ASSERT_FLOAT_IS_DETERMINATE(actual, line, message)                            UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_DET)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_INF(actual, line, message)                                UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_INF)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_NEG_INF(actual, line, message)                            UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_NEG_INF)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_NAN(actual, line, message)                                UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_NAN)
#define UNITY_TEST_ASSERT_FLOAT_IS_NOT_DETERMINATE(actual, line, message)                        UnityAssertFloatSpecial((_UF)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_DET)
#endif

#ifdef UNITY_EXCLUDE_DOUBLE
#define UNITY_TEST_ASSERT_DOUBLE_WITHIN(delta, expected, actual, line, message)                  UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_EQUAL_DOUBLE(expected, actual, line, message)                          UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_EQUAL_DOUBLE_ARRAY(expected, actual, num_elements, line, message)      UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_INF(actual, line, message)                                   UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NEG_INF(actual, line, message)                               UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NAN(actual, line, message)                                   UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_DETERMINATE(actual, line, message)                           UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_INF(actual, line, message)                               UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF(actual, line, message)                           UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NAN(actual, line, message)                               UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE(actual, line, message)                       UNITY_TEST_FAIL((UNITY_LINE_TYPE)line, UnityStrErrDouble)
#else
#define UNITY_TEST_ASSERT_DOUBLE_WITHIN(delta, expected, actual, line, message)                  UnityAssertDoublesWithin((_UD)(delta), (_UD)(expected), (_UD)(actual), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_EQUAL_DOUBLE(expected, actual, line, message)                          UNITY_TEST_ASSERT_DOUBLE_WITHIN((_UD)(expected) * (_UD)UNITY_DOUBLE_PRECISION, (_UD)expected, (_UD)actual, (UNITY_LINE_TYPE)line, message)
#define UNITY_TEST_ASSERT_EQUAL_DOUBLE_ARRAY(expected, actual, num_elements, line, message)      UnityAssertEqualDoubleArray((_UD*)(expected), (_UD*)(actual), (_UU32)(num_elements), (message), (UNITY_LINE_TYPE)line)
#define UNITY_TEST_ASSERT_DOUBLE_IS_INF(actual, line, message)                                   UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_INF)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NEG_INF(actual, line, message)                               UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NEG_INF)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NAN(actual, line, message)                                   UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NAN)
#define UNITY_TEST_ASSERT_DOUBLE_IS_DETERMINATE(actual, line, message)                           UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_DET)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_INF(actual, line, message)                               UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_INF)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NEG_INF(actual, line, message)                           UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_NEG_INF)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_NAN(actual, line, message)                               UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_NAN)
#define UNITY_TEST_ASSERT_DOUBLE_IS_NOT_DETERMINATE(actual, line, message)                       UnityAssertDoubleSpecial((_UD)(actual), (message), (UNITY_LINE_TYPE)line, UNITY_FLOAT_IS_NOT_DET)
#endif

//End of UNITY_INTERNALS_H
#endif